PLoS One has a new
paper on a Mongolian imperial tomb dated to 1130–1250 AD, which is the early Mongolian era. Here's the table with the Y-haplogroup results:
The authors make the sensible conclusion that these Mongolians had paternal ancestry from somewhere in Western Eurasia. But they also make this stupid comment:
Similarly, the high frequency of R1b-M343 in geographic regions associated with the past Mongol khanates including the Golden Horde (from Ural Mountain to Western Siberia, which includes Russia, Ukraine, Belarus, Poland, Azerbaijan, Kazakhstan, and Uzbekistan), Ilkhanate (Iran and neighboring territories including Armenia, Turkey, Georgia, Afghanistan, Syria, and Tajikistan), and Chagatai Khanate (from the Aral sea to the Altai mountain, including Pakistan (Hazara), Uzbekistan, Kazakhstan, Tajikistan, India, and China), strongly suggest a close association between the Y haplotype R1b-M343 and the past Mongol Empire.
No, the distribution, frequencies and subclades of R1a or R1b do not show any sort of meaningful correlation with the past Mongol Empire.
The most obvious explanation, although not the only possible one, for the presence of R1a and R1b lineages in Mongolian imperial remains are the migrations of the Afanasievo and/or Andronovo people into the Altai region from the Eastern European steppes during the Bronze Age. See here...
Your delusion is akin to claiming that Rurik dynasty had a paternal ancestry somewhere in East Asia.
ReplyDeleteR1a-Z93 and R1b-Z2103 expanded from Eastern Europe into Asia during the Bronze Age. No delusions about it.
ReplyDeletehttp://eurogenes.blogspot.com.au/2016/04/signals-of-ancient-population.html
Now piss off you freak.
LOL you are quoting your own delusion as proof? Talk about conceit.
ReplyDeleteI'm quoting these papers knucklehead.
ReplyDeletehttp://www.nature.com/ng/journal/v48/n6/full/ng.3559.html
http://www.nature.com/nature/journal/v522/n7555/full/nature14507.html
And let's throw in this one...
http://www.fsigenetics.com/article/S1872-4973(14)00116-1/abstract
You must be bored out of your brains to troll here. Or you're dumber than even I gave you credit for.
Hold on. Now I am totally confused. I thought R1a-Z93 came out of India. So, did the Mongols take it there before that time?
ReplyDeleteMongol elites - it seems were fathered by Aryan tribes on indigenous women
DeleteThere is an article about 7000 years old Baikal graves and the oldest grave had R1a so its presence clearly dates back prior to Bronze age.
ReplyDeleteR1a in this pseudo-Golden Family was a common warrior, possibly a sacrificial victim. The article says so.
Z2103 was not typed. Only the most generic M343 that defines R1b at the highest upstream according to YFull. Their conclusion that you ridicule is based on YSTR and it is really crude and probably includes many too distantly related men.
This R1b is probably the same type as the one found in Elgyn Gol and Manchu etc.
As usual the quoted papers don't say what you claim.
ReplyDeleteThere is an article about 7000 years old Baikal graves and the oldest grave had R1a so its presence clearly dates back prior to Bronze age.
ReplyDeleteI'm talking about R1a-Z93, which is the subclade that is found in Middle and Late Bronze Age European Kurgans and shows up in Mongolia during the Bronze Age with people of mixed pigmentation.
http://www.fsigenetics.com/article/S1872-4973(14)00116-1/abstract
You know, Mongolia, where the tomb is located.
And there's no reason to assume that the R1b in the Mongolian tomb isn't originally from Afanasievo migrants, since eastern Yamnaya is basically all R1b at this stage.
You're delusional and plain stupid with a cherry on top. Fuck off.
This is your blog with the ability to delete what you don't like. On neutral grounds you know what I can do to you.
ReplyDeleteWhat is your problem exactly?
ReplyDeleteThere were migrations from Europe to the Mongolian Altai during the Bronze Age of people belonging to Y-DNA R1.
Yes or no? If no, then this paper is wrong why?
http://www.nature.com/nature/journal/v522/n7555/full/nature14507.html
And As I said the man was probably a sacrificial victim like the other female. I am sure your chest swells in pride for your distant uncle.
ReplyDeleteHe was a warrior. But I don't give a crap what he was and how he died. I'm just explaining the most likely reason why R1a and R1b with western haplotypes ended up in these imperial graves.
ReplyDeleteOn neutral grounds you know what I can do to you.
ReplyDeleteYou're too stupid to debate me successfully except in your own mind. LOL
The paper initially lost me for many things. And then I looked up the list of authors and it cracked me up.
ReplyDeleteIt even goes so far as to speculate that the "Queen"s husband was a Caucasoid male.
The principal author appears to be a Mongolian graduate student who still failed to earn a PhD after 10 years or so and the rest of the panel is made up of medical doctors and the likes. The corresponding author belongs to "Department of Science and Cultural Heritage".
"You're too stupid to debate me successfully except in your own mind. LOL"
ReplyDeleteNobody can debates you. The reason is best left to your wild fantasy where everyone hates white folks.
Cited in the paper:
ReplyDelete"Although the factual nature of the statement is controversial, Persian historian Rashid-al-Din reported in his “Jami’s al-tawarikh” written at the start of the 14th century that most Borjigin ancestors of Genghis Khan were tall, long-bearded, red-haired, and bluish green-eyed, suggesting that the Genghis Khan’s male lineage had some Caucasoid-specific genetic features [44]. He also said that Genghis Khan looked just like his ancestors, but Kublai Khan, his grandson, did not inherit his ancestor’s red hair, implying that the addition of Mongoloid-specific alleles for determining hair color to the genetic makeup of Genghis Khan’s Borjigin clan was probably from the grandmother or mother of Kublai Khan, that is, the wife or daughter-in-law of Genghis Khan."
A similar thing may have happened when "Bell Beaker" males interbred with the Mediterranean/Western Middle Eastern mtDNA H women. A whole lot of EEF ancestry was inherited.
@AWood
ReplyDeleteThat is like looking for Mongoloid characteristics among N-TatC Eastern Europeans. In rare cases you find them, it is more likely due to the fact he is East European than he is TatC.
And Why is "being tall" Caucasoid characteristics? Koreans are for instance taller than most Asian "Caucasoids" including Iranians, and substantially taller than most Near Easterners.
ReplyDeleteFight the power Hector.
ReplyDeleteGoodness gracious the samples are very new , to have any such significance .
ReplyDeleteIt's still interesting that the ruling and warrior classes that moved from Europe to the Altai during the Bronze Age may have still been in place there during the early Mongol period.
ReplyDeleteNeither to draw such conclusions . Wait for the SC Asian data . Then we can have a nice cup of tea together and talk about inter ethnic marriages ;) ....
ReplyDeleteIf you read the full article it should be clear that the authors were aware that the male members were probably not of Borijigin clan. The female probably was and married to a Mongol/Central Asian prince of a different tribe. The authors are from the notorious JooAng University and they probably were just too desperate to get grants.
ReplyDeleteThat is because the female MN125 appeared to have the highest status and her supposed sons died in their 30's. Anyone familiar with Mongols' political system will realize this is impossible. A prince in his 30's born of a high ranking consort(not to mention a queen) will outrank his mother or has the same status(in case the mother was the Queen). The female has to SERIOUSLY outrank the males there.
Anyway the males are most likely M73. That is pretty much the end of Davidski's fantasy but he will keep dreaming... like M73's came from Europe during the Bronze age or something. Puahahaha.
From memory, the Eastern European Hunter-Gatherer from the Samara region might belong to M73 or a sister clade. So there's no reason why Bronze Age Afanasievo people from Eastern Europe could not have brought M73 to the Mongolian Altai.
ReplyDelete@Nirjhar007
ReplyDelete"Neither to draw such conclusions . Wait for the SC Asian data . Then we can have a nice cup of tea together and talk about inter ethnic marriages ;) ...."
Finally someone shows up with a breath of fresh air.
"So there's no reason why ...could not"
ReplyDeleteThere is no reason why they should have.
And there is no reason why Rurik could not have been a male-line descendant of Neolithic Siberians and eventually even Early Neolithic/Late Mesolithic descendants of East Asians.
This pseudo-Golden family's YSTR also matches mostly Central Asians as they should since it belongs to M73.
Samara? It is like saying since Oase was K2a K2a originated from Europe.
I have to read the paper, anyway I found an haplotype quoted on Anthrogenica and it was clearly R-M73, as Hector recognizes: "Anyway the males are most likely M73. That is pretty much the end of Davidski's fantasy but he will keep dreaming... like M73's came from Europe during the Bronze age or something". I have many times said and very likely demonstrated that R-M73, thought from everyone Asiatic, is older in Europe and was amongst the Samara samples. Thus to find it in the 13th century AD doesn't mean anything about its origin, if not that R1a and R1b expanded from Europe to Asia. That will be clear with aDNA. Perhaps Hector should do his best in improving his autosome...
ReplyDeleteM73(or its ancestors) may have come from Europe at some point. But your chests don't need to swell in pride since there is very little regional genetic continuity.
ReplyDeleteYou have a very nasty tendency to consider something to be yours when
1 It is about male line.
2 At some point in its history it was in Europe
On the other hand if something came from outside
you claim
1. Too long ago
2. Not enough evidence
Actually I quite agree on those points Hector.
ReplyDeleteKarl_K said...
ReplyDeleteFinally someone shows up with a breath of fresh air
..............................................................................................
You can never be his gf!.
"Here, we propose that Genghis Khan and his family carried Y-haplogroup R1b-M343, which is prevalent in West Eurasia, rather than the Y-haplogroup C3c-M48, which is prevalent in Asia and which is widely accepted to be present in the family members of Genghis Khan. Additionally, Tavan Tolgoi bodies may have been the product of marriages between the lineage of Genghis Khan’s Borjigin clan and the lineage of either the Ongud or Hongirad clans, indicating that these individuals were members of Genghis Khan’s immediate family or his close relatives."
ReplyDeleteI think you skipped the most sensational part of that article!
I don't know if you remember when someone said that Genghis Khan, an hg. C3, would have had 13 or 16 millions descendants, but someone said that his wife, the beloved one, was a prisoner of another tribe and was given back with her belly enlarged... thus, as we don't know really who these persons were, I'd wait before making unsupported hypotheses. Certainly if also Genghis Khan belonged to the Villabruna clan, would be to me motive of proud, because anyway he was an extraordinary man. Anyway Mongolians has been better than Egyptians.
ReplyDeleteBut Hector is speaking with me without quoting my name? Then my friend was right when said that he is obsessed from me!
The fact that the R1b and R1a found in this study have most of their Y-STR matches in Central Asia (SC Asia and Xinjiang included) means that they likely belong to the subclades M73 and Z93 respectively. Ancient DNA evidence so far seems to indicate that those subclades of R1b and R1a originated somewhere in Eastern Europe despite the fact that they are today much more concentrated in the continent of Asia than in Europe due to the Bronze Age migrations from Eastern Europe to Asia.
ReplyDeleteAs for Y-DNA haplogroup N, according to the latest genetic analyses, it expanded to Eastern Europe only within the last 5,000 years and is originally from East Eurasia, which means it probably brought some East Eurasian (Mongoloid) genetics with it when it arrived in Eastern Europe and can explain much of the East Eurasian ancestry there.
@ Onur
ReplyDelete"means that they likely belong to the subclades M73 and Z93 respectively"
The R-M73 is certain out of any doubt. I haven't studied the R1a, but I'd say downstream R-Z94 at least, being Z93 diffused above all in Europe, and Westernmost I'd say, also in Italy (see Grisi, etc.)
"...rather than the Y-haplogroup C3c-M48, ..."
ReplyDeleteC3c-M48 was never a candidate for Chinghis Khan's lineage;M48 is a candidate for Aisin Gioro, Manchu Dynasty. This paper is really poor, actually comical.
@Gioiello
ReplyDeleteTo be specific, I think the R1a individual belongs to the subclade Z2124, the dominant Z93 and Z94 subclade of R1a in Central Asia.
@ Onur
ReplyDeleteI have no time now, otherwise I think I'd be able to understand also the last SNP, but consider H4=13, which should be 12 in FTDNA format.
It's not my quote, it was Rashid-al-Din, like it or leave it. It's not just being tall, which was also a characteristic of Yamnaya, but also blue eyes and red hair. Not exactly common in indigenous East Asian populations, and no reason to assume these mutations were common in and around 1100AD.
ReplyDeleteBut then Chinghis Khan's actual portrait does not show any of it. Also this paper says that all individuals were Mongoloids.
ReplyDeleteRashid al Din is not a reliable source;Read Mongolian scholars' voluminous publications on this or shut up.
In that part of the world blue eyes are uncommon but not completely unknown. On the other hand red hair is not that uncommon.
ReplyDeleteStories about blue eyes and red or yellow(blonde) hair are fairly common probably bogus stories around the world. Sun's family as in Romance of Three Kingdoms fame(2-3rd C. Southern China) is said to have had blue eyes and some other stupid fantasies I don't remember.
Even if Chinghis Khan was M73 and had blue eyes and red hair, it is most certain that it has nothing to do with M73.
The paper is quite bad and most of their conclusions are either just wrong or lack definitive evidences. I dont see why they have to be descendants of Dschingis Khan maybe i missed something . We can only surely say that they were aristocrats and belonged to the elite. But still very interesting that R1 males were still so powerful much after Indo-Europeans were pushed out of the region and some even think that the Ottomans were R1a (some of their alleged descendants belong to R1a)
ReplyDeleteThe first people to develop horse-based steppe pastoralism logically ought to have spread over the whole steppe east-west.
ReplyDeleteIf they raided the peoples to their south they would eventually come to look like them with only the y dna as a clue to the history.
If the y dna flipped at some later point then it would suggest the first people to spread over the steppe got out competed for some reason at some later point by a second group.
so group one can say "we did it first, yay us" and the second group can say "yeah but we kicked you out later, yay us"
same data with spin for everyone
(the Chinese records talk about red-haired steppe barbarians so the idea that Yamnaya types spread over the steppe in the Bronze age or before but were then later displaced from the east doesn't seem particularly strange so i'm not sure what the problem is)
Coldmountains
ReplyDelete"very interesting that R1 males were still so powerful much after Indo-Europeans were pushed out of the region and some even think that the Ottomans were R1a"
I think it's likely connected to the way tribal alliances seem to have worked. If you have a lot of patrilineal clans combined in tribal alliances and one alliance loses to another i imagine some of the sub-clans simply swear loyalty to the new boss tribe.
I think as long as the "horse highway" Eurasian Steppe was in full function (so until when the Mongol dynasties died out), there was always an exchange of genes occurring across it.
ReplyDeleteR-M207 might be telling.
ReplyDeleteWaiting for more data is always good, but I'd bet we are looking at East-to-West-to-East movement.
The lack of expansion into West Europe should also be very telling.
@Hector.
ReplyDeleteThere is no reason to doubt Rashid-al-Din's claims other than what they are.
Hey Hector,
ReplyDeleteYou need to study your R1 subclades a little better.
No doubt that Z93 is originally from Eastern Europe, and M73 likely is too.
"There is no reason to doubt Rashid-al-Din's claims other than what they are"
ReplyDeleteNo use telling me that. Tell that to Mongolian scholars as well as to 99 percent of Western academia.
"You need to study your R1 subclades a little better."
Actually you should.
The samara R1b is 7000BP and was negative for M478 and other SNPs on that branch. Since M73(so far equivalent to M478) has TMRCA of 7300BP and assuming that they tried more SNPs other than M73 and M478 on that branch it is nearly certain that Samara does not belong to this branch which means Samara line diverged from M73 line more than 13500 years ago.(Even if they tested only M478 it is still unlikely since the only scenario to your liking is that M478 occurred very near 7000BP on a branch 7300BP - 13500BP)
Presence of such a distant cousin gives no indication where M73 line existed at that time and moreover it is very unlikely that already diversified M73 line(by the time of Bronze Age) moved over to Central Asia whole-sale leaving very few in Europe.
I doubt you understand what I am saying. Bah.
"ottomans were R1a"
ReplyDeleteLet's try not to sound so pathetic
Hector,
ReplyDeletePeople a lot more capable than you have looked at the Samara sequence.
https://drive.google.com/file/d/0B9o3EYTdM8lQSnowY29UU09HSmM/view?usp=sharing
So the stage is set for the R1b in Mongolia to be from the Bronze Age Eastern European steppes.
But I doubt you understand what I am saying. Bah
"very interesting that R1 males were still so powerful much after Indo-Europeans were pushed out of the region"
ReplyDeleteYou guys crack me up, man.
Say the Newegg owner Fred Chang is Q-M120(fairly common haplo among northern Chinese). 20000 years later he and his son were found with all his luxury goods by future archaeologists. Upon genotyping them they ponder " Wow, even after Native Americans had been wiped out there were still very wealthy Q guys on the US territory."
"No use telling me that. Tell that to Mongolian scholars as well as to 99 percent of Western academia."
ReplyDeleteGraves are being found. In light of new data, academia will be adapting.
@Hector
ReplyDeleteYou need to rise above your mental problems.
The spread of warrior elites from the Eastern European steppes during the Bronze Age had a profound impact on many cultures way down the line, both in Europe and Asia.
This is interesting and important and needs to be studied closely. And it will, so get used to it.
warrior elites from the Eastern European steppes
ReplyDeleteThey were warrior elites, and lived in the Eastern European steppes. But they also lived in Siberia.
And which came first...
"People a lot more capable than you have looked at the Samara sequence."
ReplyDeleteI am confident that there are not all that many in this field. Certainly not among amateurs.
I am not going to claim I am smarter than Field Award winners or Nobel Physics winners but you are not going to browbeat me that easily.
Do you even know how to read this kind of graph?
10124 is the case number, it is not an SNP. They have not tested any other SNPs on that branch to locate Samara on that branch. TMRCA estimate of 7300BP makes it very unlikely. However it can be that Samara is on a branch diverging earlier but running collaterally with the M478 line.(I erred here in my previous post and you obviously did not catch it) Even if that is the case it still does not say "they were there together".
However a better bet is that Samara still falls on the M269 side(since TMRCA of extant M269s is 6500BP) or even on a branch that diverged earlier.
"Graves are being found. In light of new data, academia will be adapting."
ReplyDeleteGosh, another loon. Good Bye.
@Hector
ReplyDelete10124 is the case number, it is not an SNP. They have not tested any other SNPs on that branch to locate Samara on that branch.
They didn't report them. But they did test them. The BAM files are here...
http://www.ebi.ac.uk/ena/data/view/PRJEB8448
However a better bet is that Samara still falls on the M269 side(since TMRCA of extant M269s is 6500BP) or even on a branch that diverged earlier.
Bahaha.
No chance.
@Atriðr
ReplyDeleteI'm not aware of any warrior elites in Siberia prior to the Andronovo people, are you?
Some useful new reading here on this topic...
https://www.academia.edu/28416779/Anthony_2016_chapter_1_and_2_final_proofs_Samara_Valley_Project_and_evolution_of_pastoral_economies_in_Eurasian_steppe
Elite dominance only works for western european genetic fantasies I guess.
ReplyDeleteShould be no surprise to hear of r1b in mongols since from historical references we know that ghengis khan had red hair and green eyes.
It is most popular to assume that language = genetic = leaders but many times it's not the case especially for a true elite dominance as with the Normans - who conquered everyone and then promptly seemingly disappeared as a people.
The early settlers of north eurasia were obviously white and what we think of as mongols did not come west until relatively recently. Probably they raided and took so many slaves and wives from the SE that eventually they became 'asian' in spite of their original affinities. Not sure why this is a controversy we basically already know all this from history and dna.
Some useful new reading here on this topic...
ReplyDeleteThanks, just downloaded. I'll read it, then respond.
Gosh, another loon. Good Bye.
If I'm a loon, then I'm in good company. And in all likelihood, your conclusions intersect with mine so drop the chip on your shoulder.
I'm not aware of any warrior elites in Siberia prior to the Andronovo people, are you?
ReplyDeleteAfanasevo is older and is South Siberia.
Tavan Tolgoi and Elite cemetery,
ReplyDeleteANU, isotope-study
"Food fit for a Khan: Stable isotope analysis of the elite Mongol Empire cemetery at Tavan Tolgoi, Mongolia"
https://researchers.anu.edu.au/publications/98072
University of Arizona-dating-
"DATING THE TAVAN TOLGOI SITE, MONGOLIA: BURIALS OF THE NOBILITY
FROM GENGHIS KHAN’S ERA"
Golden Falcon-
"The golden ring with the falcon seal inside it, from grave 1 (2004), shows a close relationship with
burial sites dating to the Golden Horde lineage of Genghis Khan. The falcon is mentioned in the
histories dating from Genghis Khan’s Golden Horde, including historical manuscripts and legends
of the 12th–13th centuries. For example, in the 63rd part of the Secret History of Mongols
(Damdinsuren 1947), Temüüjin (Genghis Khan) was described as a falcon,"
https://journals.uair.arizona.edu/index.php/radiocarbon/article/view/2964/2723
@Atriðr
ReplyDeleteBut Afanasievo originated in Eastern Europe mostly from local hunter-gatherers. Afanasievo genomes are identical to those of Yamnaya. See map here...
https://drive.google.com/file/d/0B9o3EYTdM8lQdzRlWXBQaXlnMGc/view?usp=sharing
@Hector
ReplyDeleteSo now you want me to hold your hand as you fumble about with a BAM file?
Really?
While at it, Afanasevo is closer to the Steppe ancestry found in South Asians than is Andronovo.
ReplyDeleteThis is a big tell.
And the paper you linked me itself, mentions info that Anthony himself hasn't connected. Here's a quote from Anthony:
"Finno-Ugric, the prehistoric ancestor of the Uralic languages spoken today in the forest zone north of the Samara Valley, borrowed vocabulary from both common Indo-Iranian and early Iranian (Koivulehto 2001), proving that these ancient languages bordered each other..."
Indo-Iranian has zero Finno-Ugric loan words. But Finno-Ugric has Indo-Iranian loan words... some try the elite dominance model to explain, but pretty much every language that is bordered to each other, exchange words.
Looking at Afanasevo EMBA vs. Andronovo MLBA in South Asians, looking at the linguistic Finno-Ugric - I-I loan words... the movement starts pointing outwards of Afanasevo (or thereabouts)... and also pointing to an East to West model.
East to West model.
ReplyDeleteNope.
Like I said, Afanasievo genomes are identical to Yamnaya genomes; a mixture of Eastern European Hunter-Gatherers, Caucasus Hunter-Gatherers and Near Eastern farmers.
You're basically now arguing that up is down and down is up when you're saying that people like Afanasievo migrated to Eastern Europe, because they'd be migrating to their homeland.
"Like I said, Afanasievo genomes are identical to Yamnaya genomes; a mixture of Eastern European Hunter-Gatherers, Caucasus Hunter-Gatherers and Near Eastern farmers."
ReplyDeleteI know that.
But Afanasevo and Andronovo are a little different; basically Andronovo is Afanasevo with exposure to more CHG and Near Eastern farmers.
How much ANE does EHG have?
"So now you want me to hold your hand as you fumble about with a BAM file?"
ReplyDeleteYou are bluffing. LOL. It is impossible to go through them with YFull tree unless you have a table ready. I don't think YFull guys even registered their commercial SNPs with NCBI.
Anyway even Genetiker missed it.
He may be a nut but he has a lot of time on hands.
Even if Samara is on that branch if it diverged early enough it still says nothing about the possible origin of extant M73's. The branch formation was 13500BP so I need the list of SNPs shared with M73 line and those that got negative calls to make the time estimate of divergence since there is 0 chance that it is a direct ancestor of M73's(no negative call).
@Atriðr
ReplyDeleteI know that.
Doesn't seem like you know much on the topic, because you seem to be claiming that Eastern European and Caucasian Hunter-Gatherers mixed somewhere in Asia to produce Yamnaya and Afanasievo.
But they mixed in Eastern Europe on the western steppes.
But Afanasevo and Andronovo are a little different; basically Andronovo is Afanasevo with exposure to more CHG and Near Eastern farmers.
Nope, Andronovo is Yamnaya with exposure to Middle Neolithic European farmers, and thus almost identical to Corded Ware from Central Europe.
EHG are about 75% ANE overall. But so what, your East to West model doesn't fly.
Not "no negative call".
ReplyDeleteI meant "no extra SNPs" for it to be the direct ancestor.
But they mixed in Eastern Europe on the western steppes.
ReplyDeleteYes, they did. Never claimed otherwise.
EHG are about 75% ANE overall. But so what, your East to West model doesn't fly.
Exactly. That was the point of my question.
ANE went to Eastern European Steppes. Mixed/Conquered. Then went back to Afanasevo area.
Back and forth. Back and forth.
Where the first Indo-European languages started, that's another story. But EHG are basically the ANE conquerors.
Doesn't seem like you know much on the topic, because you seem to be claiming that Eastern European and Caucasian Hunter-Gatherers mixed somewhere in Asia to produce Yamnaya and Afanasievo.
ReplyDeleteNope. They mixed in Yamnaya or somewhere in that zone. Not in Asia. Why would they? The Caucasus mountains aren't there.
@Hector
ReplyDeletehttp://www.anthrogenica.com/showthread.php?4664-Request-Y-DNA-haplogroup-results-from-Allentoft-2015&p=91529&viewfull=1#post91529
Nope. They mixed in Yamnaya or somewhere in that zone. Not in Asia. Why would they? The Caucasus mountains aren't there.
ReplyDeleteThen why are you claiming that Afanasievo was native to Siberia, as opposed to an offshoot of Yamnaya (or an offshoot of proto-Yamnaya)?
Afanasievo was the first group from Eastern Europe that moved to Asia, and they weren't warriors as such, more like cow herders.
The warrior thing developed more with Sintashta in the southern Urals, and was carried to Asia by its offshoot Andronovo.
Then why are you claiming that Afanasievo was native to Siberia, as opposed to an offshoot of Yamnaya (or an offshoot of proto-Yamnaya)?
ReplyDeleteI'm not. I'm claiming South Siberia inhabitants conquered Eastern Europe. Became something new through the mix, then went backwards with new knowledge and blood to form Afanasievo. Then this was repeated again by a later group: Andronovo.
It got lost in translation because I brought it up against Andronovo as it is useful to look at the model using the latest EMBA/MLBA data.
Afanasievo was the first group from Eastern Europe that moved to Asia, and they weren't warriors as such, more like cow herders.
I doubt that. They knew metal work. But I'll wait here for more data.
Sintashta. Well, that's a conundrum. I used to be a firm believer in that too. But that lack of Andronovo in South Asia gave me pause. I'm still working this one out, but it's going to be a modified version of the current model.
Only 3 SNPs analyzed.
ReplyDeleteY13872+, M478-, Y13866-
But if you still require results even if it is too crude...
2/3 x (13500-7000) ~ 4400 You get more than 11000 BP as the divergence time.
This tells nothing about the origin of this branch. It may very well be that it moved from Siberia to Eastern Europe/Western Asia.
There may be more SNPs that got calls. Either positive or negative.
10 SNPs should be enough for a rough estimate.
Unless there is an app it takes too much time.
If you do it manually just a single SNP will take like 30 min.
Jeong Ann(who made the KM marker system still in use by researchers) actually did it manually. He told so...
This case is easier since I can use YFull company's SNPs.
I think Genetiker should do it. He beats all of us in free time.
@Coldmountains
ReplyDeletesome even think that the Ottomans were R1a (some of their alleged descendants belong to R1a)
Those people who claim to be patrilineal descendants of the House of Osman (the Ottoman dynasty) on Ysearch have not been confirmed to be so and the living representatives of the House of Osman do not verify the existence of any House of Osman members who have taken a genetic test. Thus the R1a affiliation of the House of Osman rests on shaky ground.
Russian H/G 5640 BC+/-
ReplyDelete-placement-R1b-M73-Y13872/ downstream clusters
Bashkir-Bashkorstan_Akyar
Mongolian-Mongolia,_Zavkhan
Kolomets, Ukraine
Hazara, Pakistan
http://www.kumbarov.com/ht35/R1b-M343xM269%20Y-DNA%20tree_04_07_29_2016.png
Highly doubtful that it is Genghis Khan's haplogroup, considering the distribution of R1b-M73 today. Genghis's descendants by all indications were very successful at carrying on his paternal line. To see so little of it survive in the former territories of the Mongol Empire would be unlikely. I do not think that the paper's authors could've or should've went that far. It was an elite tomb and high in status, but that could've corresponded to any number of elite families from either the Mongols or their allies/vassals. The Mongols were known to have employed a large population of "Semu" drawn from various populations of West and Central Asia, who in turn became prominent and powerful, and intermarried with the Mongol ruling class.
ReplyDeleteAs to where R1b-M73 came from, the argument is as amusing as it is petty. Clearly there is no 100% fool proof way with current methods and data to show that a particular ancient haplogroup could have originated from only one specific location. Why try to insist on it? Parsimony favors Eastern Europe or the region of Siberia immediately east of it, leave it at that.
Why try to insist on it? Parsimony favors Eastern Europe or the region of Siberia immediately east of it, leave it at that.
ReplyDeleteWith an approach like that, we'd never have pondered any mysteries and would still be living in caves.
We have multiple strings of data: linguistic, archaeological, and biological.
We'll find the answer soon enough.
I hate to quote wikipedia but ...
ReplyDeletePhysical appearance
The closest depiction generally accepted by most historians is the portrait currently in the National Palace Museum in Taipei, Taiwan, which was drawn under the supervision of his grandson Khubilai during the Mongol Yuan dynasty and depicts Genghis Khan with typical Mongol features.
And someone tells me that ,instead, I have to trust the words of a certain Persian guy executed for corruption. That is supreme loonitude.
The portrait may be interpreted as showing slightly red eyebrows but clearly very brown eyes.
And what does any of these has to do with "revising according to archaeological results"? No hair sample or eyeballs were found. Skeletal features were all Mongoloid. ??
A loon is a loon.
@Atriðr I'm not saying to cease research on the subject, but to stop insisting on it when the methods and data are insufficient for proving either, or indeed any number of, possible locations. What ultimately will be necessary to show the area from which M73 spread is more data, especially ancient DNA, or different methods, but even then it won't be 100% because you can always make up a less parsimonious model to explain the same samples. I've worked on statistics long enough to know that the numbers never lie; rather it's the people who use them to push their own agendas who can twist anything into supporting their own views.
ReplyDelete"Russian H/G 5640 BC+/-
ReplyDelete-placement-R1b-M73-Y13872/ downstream clusters"
That is false. It was done by amateurs.
Samara clearly is not directly ancestral to M73 since it was 7000BP and it gets negative call on probably at least half of the SNPs on 7300BP - 13500BP branch.
Much like MA1 is collateral to the ancestors of R1-R2, Samara runs collaterally to the direct ancestors of modern M73's.
if you are capable of understanding...
@Lathdrinor
ReplyDeleteMaybe you should re-read my comments. There's plenty of data and the data is talking. The picture might not be perfect, but it's starting to come together. And if new data comes in - good, more fun.
I wrote a lot, as usual against all, about the possible origin also of R-M73 in Western Europe rather than in Asia. And everyone should know that, when the R1b were found in Samara and everyone thought having found the proof of the origin of R1b from Eastern Europe, I wrote a lot saying that those samples were only due to a migration of some limited haplotypes around R-L23 from West. After has been found Villabruna, 100% WHG, and everyone should know that not only Samara but Anatolians and Middle Easterners were partially due to a migration from the Villabruna clan and not the other way around. Of course I said that some haplotypes downstream R-L23 may have been born in Eastern Europe and migrated later Westward, as R-CTS7763 and some subclades of R-L584 or L277, but my thinking is that already when the migration from West happened (perhaps the migration of the hunter-gatherers during the invasion of the agriculturalists from Anatolia/Balkans), some close haplotypes stayed in the West, not only the R-L51 but also my R-Z2110, which generated the downstream subclades of R-CTS9219 which migrated Eastward later.
ReplyDeleteBut I think that also about the R-M73 haplotypes happened the same, not being the Western haplotypes of Eastern origin. These are the reasons:
European/Asian clusters:
DYS390=25,26 / 19,24
DYS389II=+15 / +16 or more
DYS459b=10 / =9
DYS442 modal 14 / modal 12
DYS537 modal 11/ modal 10
DYS444 modal 13 / modal 12
DYS481 modal 22 / modal 24
DYS487 modal 14 /modal 13
Anyway this European haplotype is the weirdest:
180669 Mathis Rapp, b. 1645 Boofzheim, Bas-Rhin, Alsace France R-M73
12 25 14 10 14-14 12 12 12 14 12 29 16 9-10 11 11 22 15 20 31 13-13-15-16 10 10 19-25 15 18 18 18 32-36 14 10 11 8 16-16 8 11 10 8 11 11 13 23-23 17 10 14 12 13 8 15 22 20 13 12 11 16 11 11 12 12
and I think that a Full Genome and an YFull exam would be very interesting.
@Atrior I don't know what you would consider plenty because what is presently available for M73 is clearly insufficient for ascertaining its location of origin. In fact you can even challenge the same for the much more well-studied M269, which has an order of magnitude more samples, and yet was/is nonetheless a source of controversy. People, especially on the internet, will commonly say the case is closed only for it to be opened again a year later. Instead of trying to twist the numbers towards one particular theory, it is much more academic and professional to accept all possibilities and to simply state what is more parsimonious. That would be an objective description as opposed to what went on in this paper which was clearly not objective.
ReplyDeleteI still don't understand what the big fuss is about? Let me just quote myself...
ReplyDeleteThe most obvious explanation, although not the only possible one, for the presence of R1a and R1b lineages in Mongolian imperial remains are the migrations of the Afanasievo and/or Andronovo people into the Altai region from the Eastern European steppes during the Bronze Age.
What I wrote there shouldn't be a problem for anyone who is able to comprehend plain English and doesn't suffer from any serious mental issues.
@Lathdrinor
ReplyDeleteI get the gist of what you are saying; but you are projecting these ideas on the wrong crowd.
As I mentioned way above, in light of new data, adapt.
Wealth of linguistic & archaeological data; biological data is pouring in every month.
You say: Instead of trying to twist the numbers...
Who do you claim is doing this? Debate them directly.
Davidski's fixation on "Europe" is comical.
ReplyDeleteI have not exactly measured it but it appears that Samara to Lake Baikal is shorter than Samara to Spain. They probably did not think as much when they had to move to Kazakstan, Uzbekistan or even Lake Baikal as they would have if they were forced to move to France. They clearly did not think of themselves as Europeans nor is it likely that they felt any kind of kinship to the folks far West and far South in Iberia.
If they lived they would be LOLOF when they realize some guy - not much related to them - is worshiping them, taking great pride in someone else's ancestors with a image of horse-riding(even before the domestication of horses much less riding them) super-brawn flexing, kick-ass blonde military elites.
@Atrior
ReplyDelete"Sintashta. Well, that's a conundrum. I used to be a firm believer in that too. But that lack of Andronovo in South Asia gave me pause. I'm still working this one out, but it's going to be a modified version of the current model."
Apparently Kuzmina's writings have indications are that andronovo may not have moved south, rather sourthern andronovo or fedorovo is atleast as old as andronovo proper. Its just that archeology and sampling in places like uzbegistan and tajikistan are not up to par with places further north.
Same goes for afnasievo. It cannot simply called a yamnaya offshoot given its already known early chronology. It is under sampled both in terms of digs as well as ancient dna.
I don't think there's any fuss.
ReplyDeleteCaucasoids have been in Mongolia for millennia. We have the archaeological proof; historical proof in records; and now the DNA is coming in.
@postneo
ReplyDeleteThe dates for Afanasievo have been revised. It's not older than Yamnaya. You should know that.
And no, Z93 did not enter the steppe from the south. You should know that too.
Same goes for afnasievo. It cannot simply called a yamnaya offshoot given its already known early chronology. It is under sampled both in terms of digs as well as ancient dna.
ReplyDelete100% correct.
But until we find, we cannot claim... however, it will help to prospect.
Afanasievo itself however, shows the Eastern European influences. So talking about unknowns using current semantics is confusing as was demonstrated earlier.
ReplyDelete@Atrior it should be obvious that I'm addressing anyone who thinks they can ascertain where R1b-M73 came from using only present evidence & methods, which are *insufficient* for this task. For an even remotely accurate picture, a comprehensive set of M73 subclades would need to be determined, and a corresponding set of ancient DNA samples collected. This Mongol sample from the 12th century is one step in a long process, which has barely begun for M73, while for M269 it might be said to be well under way. There is no need to adapt because there is barely anything relevant to that question in this paper and the authors were way too quick to jump to conclusions in almost every claim they made. I consider this a poor paper overall in its interpretation of the data though the data itself is of value.
ReplyDeleteStirrups are not 'sine qua non' for horsemen warriors, a proper saddle is enough and cavalry was used centuries before the Avars or Huns. Examples of Celto-Roman four-pommeled saddles were tested and proven to be efective at keeping the rider on top despite impacts. Riders could force the leg, on the side of the blow, up against the saddle-pommel to force their bodies straighten back up.
ReplyDeleteAdditionally stirrups were even probably first developed to help the rider get on top of the horse, which is why early depictions only show one stirrup. Sure, they ended up being an additional help for fighting, but they are not necessary.
Obviously I'm not picturing ramparing hordes of horseback riders during the bronze age laying waste to everything, but the point remains, saddles are not that critical, and the fact that the Scythians did it so early on should have been enough to prove that point.
"The dates for Afanasievo have been revised. It's not older than Yamnaya. You should know that."
ReplyDeleteThere's roughly a 4900km distance to deal with though.
Here are two images of those Celto-Roman saddles, in case anyone is interested:
ReplyDeletehttp://www.caerleon.net/history/army/saddle2.jpg
http://www.romeacrosseurope.com/wp-content/uploads/2015/10/saddle.jpg
There's roughly a 4900km distance to deal with though.
ReplyDeleteSo what? It's a straight run across a flat steppe.
Afanasievo is identical to Yamnaya, and it did not migrate back to Europe.
Just from technological point of view this paper would have been OK if this were 2008. Their analysis would still suck but just purely the technical side...
ReplyDeleteKoreans are like 8 years or more behind guys like Paabo. but Mongols keep feeding them the valuable remains for analysis. I know several Korean papers that came out about 10 years ago and they used absolutely wasteful, primitive and brutal methods to analyze Mongolian aDNA. They analyzed like 50 specimen each time just with 2 SNPs. O and Yap, later C. The rest you had to guess. I am sure they cut chunks of bones to just get that.
The final insult is that they were considered unreliable even by their Korean colleagues. So much valuable material for nothing.
Typing aDNA should not be a training ground for their limited expertise.
And I think it is the same JoongAng university working in Harappa or something.
Don't expect much more than this paper. Maybe like 10 SNPs at most. And 10 STR loci many of which will be no calls.
They should be stopped somehow.
Ahoy, Mateys/ dimwit's, and those suffering from mild to severe cases of Attention Deficit Disorder.
ReplyDeleteIf you don't accept Mongolian R1b M73 coming from West, then what about R1b-Z2106 West to East link ? :)
R-Z2106Y12538/Z8131 * Z2106formed 6100 ybp, TMRCA 6100 ybpinfo
R-Z2106* R-CTS8966CTS7763 * CTS8966 * CTS2437formed 6100 ybp, TMRCA 4500 ybpinfo R-CTS8966* id:NAxxxxxCHB
http://www.kumbarov.com/ht35/R1b-M269xP312xU106_tree_30_09_12_2016.png
Tabassarans, Dagestan-R-CTS8966CTS7763 * CTS8966 * CTS2437formed 6100 ybp, TMRCA 4500 ybpinfo
Guys,
ReplyDeleteI feel there is some anarchy and ethnic +racial taunts in the discussion here. I urge everybody to just calm down a bit , it is natural to have ethnocentrism from person of each ethnic groups but please there is a limit of things.
Keep things in a friendly manner , do not insult others or show offense .
I nominate that eurogenes should transform itself into a sunken circular pit, covered with sand. A palisade to erected around the top.
ReplyDeleteNow, enter the protagonists. Ritualistically, they are to be equipped with fake, symbolic sharp pointed wooden fake beaks strapped to their mouths, false cockcombs worn as wigs, and symbolic chicken's feet, complete with sharp hind-spurs, worn as boots.
Let the squawking commence!
It is likely that the R1a found in Mongolia is of this subclade:
ReplyDelete6. ..>Z280>CTS1211>Y35>CTS3402>YP237>YP582>YP578*-x2 (YP578 not tested; Big Y or Z280 SNP pack needed)
220743 Russian Federation R-Z283
13 26 16 11 11-14 12 12 10 13 11 30 17 9-10 11 11 23 14 20 32 13-15-15-16 11 12 19-23 15 17 18 19 37-39 13 11 11 8 17-18 8 11 10 8 11 10 12 20-22 15 10 12 12 14 8 14 23 21 12 12 11 13 11 11 12 13 31 15 9 15 12 26 27 19 13 12 12 12 10 9 12 11 10 11 11 29 12 14 24 12 9 10 19 15 19 11 24 15 12 15 24 12 23 19 10 15 17 9 12 11
You mean a contamination?.
ReplyDeleteLol
ReplyDelete@ Nirjhar007
ReplyDeleteVery likely not. The Mongolian sample has only about 750 years, and that person was linked to Russian R1a of to-day. What strange?
No I guess its not ..
ReplyDeleteHector
ReplyDelete"Davidski's fixation on "Europe" is comical."
A lot of (most?) people would like their "home" region to have been historically significant. Some people's home region was near the horses.
Them's the breaks.
So Genghis was a goldilocked aryan superhuman after all.
ReplyDeleteYeah! We just have to adjust the stereotypical Aryan looks a bit.:-)
ReplyDeletehttps://en.wikipedia.org/wiki/Genghis_Khan#/media/File:YuanEmperorAlbumGenghisPortrait.jpg
In the portrait, Genghis' beard and hair have a slight reddish tone. And maybe he was getting bald as many western men do.
In any case, the paper says that R1b skeletons were Mongoloid.
From the linguistic point of view, there are several words of western origin in the Mongolic languages (but I do not have time to give examples), and Mongol language has also developed masculine - feminine distinction, as IE languages, which is rare in the languages of that area.
As Afanasievo yDNA is still not coming, I only add that if these noble Mongols belong to R1b-M73, their line could be derived from the Samara hunter-gatherer y-line.
ReplyDelete"Of the total of 193 R1b-M73 chromosomes detected, all except two Russians occurred outside Europe, either in the Caucasus, Turkey, the Circum-Uralic and North Pakistan regions" (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3039512/)
Wikipedia is not very informative about M73 but they say that "R1b-M73 is reportedly the dominant haplogroup among the Kumandin of the Altai Republic in Russia."
@ Kristiina
ReplyDeleteCertainly these R-L73 belong to the Samara haplotypes and not to the Western European ones, I think older (look at a post of mine above):
But I think that also about the R-M73 haplotypes happened the same, not being the Western haplotypes of Eastern origin. These are the reasons:
European/Asian clusters:
DYS390=25,26 / 19 to 24
DYS389II=+15 / +16 or more
DYS459b=10 / =9
DYS442 modal 14 / modal 12
DYS537 modal 11/ modal 10
DYS444 modal 13 / modal 12
DYS481 modal 22 / modal 24
DYS487 modal 14 /modal 13
Of course M73
ReplyDeleteConsidering that R1b-M73 is almost non existent in Indo-Iranians, and the presumed Tocharians from Xiaohe are R1a and not R1b, my presumption is that Central Asian R1b-M73 guys spoke pre-proto-Turkic. The highest frequencies are clearly among several Turkic groups and also Samoyed-speaking southern Selkups seem to have 12,5% of M73. Indo-European similarities in Mongolic languages could rather be due R1a1 guys. Of course, more data is welcome.
ReplyDeleteOf course I think that some R-M73 from Samara (of course I think that they with all the other subclades of R1b1-L389+ came from West), present there already 7500 years ago, reached some Group in Siberia of Turkish Language, not that they were there from so long. The differentiation of Altaic from Nostratic may not be so Young, also being closer Uralic, which doesn't seems having much R-M73.
ReplyDelete@Kristiina
ReplyDeleteConsidering that R1b-M73 is almost non existent in Indo-Iranians, and the presumed Tocharians from Xiaohe are R1a and not R1b, my presumption is that Central Asian R1b-M73 guys spoke pre-proto-Turkic. The highest frequencies are clearly among several Turkic groups and also Samoyed-speaking southern Selkups seem to have 12,5% of M73.
Proto-Turkics may well have had R1b-M73, among other haplogroups, as the Proto-Turkic language was spoken as recently as the Iron Age, but I do not think the Samara hunter-gatherer, who is the earliest known R1b-M73 bearer, was speaking a precursor of the Turkic languages; he is too western in genetics, not to mention his geography and era, to be a speaker of a precursor of the Turkic languages. What do you think?
I only said that pre-proto-Turkic R1b-M73 would be derived from Samara hunter-gatherer yDNA without any suggestion about the language spoken by him. Before making any such statements, we should get some light on the relationship between Mongolic, Tungusic and Turkic languages. This R1b-M73 finding could support a genetic relationship between Mongolic and Turkic languages.
ReplyDeleteI have not been against Nostratic constructions and Samara hunter-gatherer may have spoken such a language. Apart from the gender system of the IE languages, the differences between Uralic, proto-IE constructions and Turkic languages are not so great and they share for example personal pronouns. Hittite did not make the gender distinction, so it has been suggested that proto-IE did not have gender.
You Kristiina I Gioiello
ReplyDeleteubi Caius ego Caia
(to be pronounced: ubi Gaius ego Gaia, C for G is from Etruscan tradition)
I have always spoken to you pronouncing your name, even long i
Gioiello, grazie mille!
ReplyDeleteSei un gentil'uomo. L'apprezzo molto!
@Kristiina
ReplyDeleteAccording to Davidski, pre-Proto-Indo-Europeans were a EHG population from East European Mesolithic in and around or close to the Samara area. So you disagree with Davidski about the possible pre-Proto-Indo-European identity of the Samara hunter-gatherer even if you do not regard him as pre-Proto-Turkic or pre-Proto-Altaic either. So do you think the Samara hunter-gatherer spoke an extinct language family without any connection to any existing language family? Or do you think he spoke an extinct Nostratic branch? Can you elaborate on these?
@Kristiina
ReplyDeleteHittite did not make the gender distinction, so it has been suggested that proto-IE did not have gender.
But Hittite had the animate-inanimate distinciton, which is considered a precursor to the Indo-European masculine–feminine distinction.
Onur, I do not have my mind set! I do not have a clear picture of the linguistic prehistory. I am waiting for new data. Also new linguistic data would be very welcome.
ReplyDeleteAs for pre-Proto-Indo-European, I must admit that I am more interested in Indo-Uralic, because I find it frustrating that Indo-European is hoarding everything to itself, and with respect to Uralic, almost all but Siberian stuff is defined loanwords, and this even though proto-IE already has several synonyms for the same word.
I do not know if there are any linguistic theories about pre-Proto-Indo-European. I do not know if we currently really have any means to investigate such a language? Is anyone aware of such academic papers?
I understand that you can use that concept in the discussions, in particular, in archaeological contexts and in population genetics but I do not know if you can really have much linguistic evidence in support of it at the moment.
@Kristiina
ReplyDeleteI should better not reply to you on the issue of the genetics and geography of pre-Proto-Indo-Europeans as it is David's hypothesis I am talking about, not mine, and I do not have a hypothesis on them myself. As for Indo-Uralic, I find that hypothesis interesting and worth investigating, I have done some readings on it and find it plausible, even more so than Ural-Altaic. I'd like to hear your opinions on it too as a linguist.
Now I remember that there is this North Caucasian substrate theory by R. Bomhard, to which David referred to in this post: http://eurogenes.blogspot.lu/2015/05/the-origins-of-proto-indo-european.html
ReplyDeleteI think that he is onto something with it. However, I do not think that pre-proto-IE is simply proto-IE minus Northwest Caucasian substrate; and the relationship with Uralic should also be resolved before we can confidently define the pre-proto-IE language.
@Kristiina
ReplyDeleteYes, I read that article by Bomhard and David's post about it. I also think that they are onto something. But I think the connections between the Indo-European and Uralic languages are more likely to be due to language contact than common descent. But western Uralic languages likely also have some IE substratum due to their expansions into IE lands.
We all prefer certain indications over others in order to build the picture that we want to be true. Uralic area is almost completely unsampled and we do not have any autosomal analyses, so I would abstain from making any definite statements. This is also true for most parts of Siberia, as we only have a handful of very old samples and they do not give much of a picture of the recent developments. The picture is clearer only in the Baikal - Altai area and IMO the samples show that the Uralic roots are not there.
ReplyDelete@Kristiina
ReplyDeleteWe are not totally in dark with regards to Uralic origins. We have modern genetics, ancient and modern linguistics, archeology and history that guide us in our search for ancient Uralics. Ancient DNA data currently help at least by showing where we should not look for ancient Uralics. There are indications that Proto-Indo-European and Proto-Uralic came into contact sometime in the past and more so for some of their branches after the diversification of the proto-languages. But of course more ancient DNA data are needed to know for sure where and when ancient Uralics lived and to track their migrations.
Whilst Indo-Uralic enjoys support from many linguists, IIRC, the only unequivocally proven loans are from Indo -Aryan into FU.
ReplyDeleteTo call the samara hunter gatherer even "pre-PIE" is very tenuous. Who knows what (likely extinct) language branch he spoke , and his Line, like later Khvakynsk, are not relevant for IEs. Even for more western steppe foragers, who knows what language they spoke, and how their descendants in 3000 BC acquired their putative PIE: straightforward & linearly through
Vertical inheritance, or via more complex Processes of shifts & horisontal acquisition ?
The only time depth we can go for PIE is just that - PIE. This the only reachable conclusion is that PIE existed and *spread* after the secondary products revolution and advent of metallurgy, from somehwere around the Carpatho-Caspian region, as it seems
The R-M73 samples in the "Italy FTDNA Project" aren't since now not 2 but 3:
ReplyDelete277246 Dominic Paolino b. bf 1879 Italy R-M173
12 25 14 11 13-14 12 12 11 14 13 29 16 9-10 11 11 22 15 20 31 12-15-16-16 11 11 19-24 15 11 16 17 34-35 14 10
R1b1a1 39685 Giorgio Mainenti (1826-1868) Italy R-M73
12 25 14 11 13-14 12 12 11 14 13 29 16 9-10 11 11 22 15 20 32 12-15-16-16 11 11 19-23 15 15 15 19 34-35 14 10 11 8 16-16 8 11 10 8 10 10 12 23-23 16 10 12 12 17 8 13 22 20 13 12 11 14 11 11 12 12 34 15 9 15 12 26 27 19 13 11 13 13 10 9 12 11 10 11 11 31 12 15 24 13 11 10 22 15 20 12 23 16 11 14 24 12 23 18 10 14 17 9 11 11
67866 Gioacchino Vizzaccaro, (b. 1895), Lazio, Italy Italy R-M73
12 26 14 10 13-15 12 12 13 14 13 29 16 9-10 11 11 22 15 20 32 12-15-16-17 11 10 19-26 18 15 17 18 36-36 14 10
Of course Rocca didn't recognize Dominic Paolino, even though it is easy easy...
@Rob
ReplyDeleteWhilst Indo-Uralic enjoys support from many linguists, IIRC, the only unequivocally proven loans are from Indo -Aryan into FU.
There are also proven loans from Proto-Indo-Iranian and Iranic to Finno-Ugric to my knowledge. Anyway, I wrote, "there are indications that Proto-Indo-European and Proto-Uralic came into contact sometime in the past and more so for some of their branches after the diversification of the proto-languages," so I agree that it is more strongly demonstrated that Indo-Iranian and its branches loaned to FU than that Proto-Indo-European loaned to Uralic or FU. Indeed, Proto-IE and Proto-Uralic or FU may not have come into contact. If so, this will likely have some implications for the timing of Uralic expansions towards the west.
Onur
ReplyDeleteIndeed. Although we're sort of working with two moving targets
@Rob
ReplyDeleteIndeed. Although we're sort of working with two moving targets
Yes, but we are on more solid ground with the IE movements thanks to the ancient DNA studies.
Of course all what I said about the fact that not only European R-M73 doesn't derive from the Asian one is demonstrated, but also that it is older and ancestral. In waiting that an European sample is submitted to YFull, this is already clear from the FTDNA Project: European samples are M73+ but M478-. I am waiting that also the smal's tree is updated.
ReplyDeleteDear English Lady,
ReplyDeletenot only I think that all my theories are largely demonstrated and will be conformed from aDNA (so very likley you have to write your books again), but you could begin in correcting some mistake that there is in your useful spreadsheet of the aDNA:
Sample: #YF02873 (R-Z2110) ChrY position: 17017851 (+strand) Reads: 16 Position data: 16C Weight for C: 1.0 Probability of error: 0.0 (0<->1) Sample allele: C Reference (hg19) allele: C Known SNPs at this position: Y13872 (C->T) Reference sequence (100bp): ACTGGAGTCATGTTCGTTGCTTCCTAAGTGGGCCAGGGATGTTAGCACCT
C TCTTTCTCCACTTTGGCTGCATGATTGAATCATCTAGAAAGATTTTGCAA (17017800-17017901)
----------------------------------------------------
Sample: #YF02873 (R-Z2110) ChrY position: 28765730 (+strand) Reads: 5 Position data: 5C Weight for C: 1.0 Probability of error: 0.0 (0<->1) Sample allele: C Reference (hg19) allele: C Known SNPs at this position: F8126 • Y13866 (C->A) Reference sequence (100bp): GCATATATCCCTCCAGAGCTTTTCTCTGAACAAAGTACTTACGTGTGTGG
C AGAGTGTAGGGGCGTATCTCTTATTTTGTTAATTTAATTTTCATTGTGGG (28765679-28765780)
------------------------------------------
Sample: #YF02873 (R-Z2110) ChrY position: 13865280 (+strand) Reads: 11 Position data: 11C Weight for C: 1.0 Probability of error: 0.0 (0<->1) Sample allele: C Reference (hg19) allele: C Known SNPs at this position: Y13886 (C->G) Reference sequence (100bp): TGACTTGAATGGAATGGAATGGAAAGGAATGGAAAGGAATGGAATGGAGT
C GAATGGAATGGACTGCAGTGCAATGGACTCGAATGGAATGGAAACGAATG (13865229-13865330)
------------------------------------------
Sample ID HG 17017851 28765730
YF03139 R-Y14051 T C
YF03179 R-Y14051 T C
YF02940 R-Y22195 T C
YF03139 R-Y14051 G
YF03179 R-Y14051 G
YF02940 R-Y22195 G
Russia Sok River, Samara [I0124/SVP 44] M 5650-5555 BC R1b1a M343+, L278+, [P297 equivalent PF6513+], M478-, [M478 equivalent Y13872+, Y13866- (The presence of positive and negative markers in the M478 node can reflect an intermediate stage of its formation.)], M478-, M269-
U5a1d C146T, C152T, C195T, A247G, A249d, 290-291d, T489C, A769G, A825t, A1018G, A2758G, C2885T, T3552a, T3594C, G4104A, T4312C, A4715G, G7146A, C7196a, T7256C, A7521G, T8468C, A8577G, G8584A, T8655C, A9545G, C10400T, T10664C, A10688G, C10810T, C10915T, A11605t, A12217G, G13105A, A13263G, G13276A, T13506C, T13650C, T14318C, T14783C, G15043A, G15301A, A15487t, A16129G, T16187C, G16230A, T16278C, T16298C, C16311T, T16325C, C16327T, C16519T, A8577G, A11605t, A12217G, T16189C!
Haak 2015; Sergey Malyshev; Mathieson 2015
thus not Y13866 but Y13886.
Kind Regards, Gioiello/Rathna
@Kristiina:
ReplyDelete"In the portrait, Genghis' beard and hair have a slight reddish tone. And maybe he was getting bald as many western men do."
My [Turkish] brother's beard is also spattered conspicuously with the brightest red though none of us have red hair for at least three generations (blondish hair during childhood is not uncommon, on the other hand, throughout the Middle East).
At one point I looked carefully at the facial hair of random Turkish guys some years ago, and I noticed that many dark haired guys (even black haired guys) do have reddish beards. It is an interesting phenomenon...
Of course, another thing to keep in mind is that both men and women in certain cultures (including Afghan and Pakistani ones) put henna in their hair. For a while I had thought that my paternal grandmother had reddish hair and greenish eyes -- henna and cataracts -- may she rest in peace...