Tuesday, September 26, 2017

The beast among Y-haplogroups


A lot has been written about Y-haplogroup R1a over the years. Sadly, most of it was wrong, such as its posited Pleistocene origin in the Indian subcontinent and subsequent migration to Europe.

In all likelihood, R1a was born somewhere in North Eurasia. More importantly, its R1a-M417 subclade, which encompasses almost 100% of modern-day R1a lineages, no doubt came into existence somewhere on the Pontic-Caspian (or Western) steppe in what is now Ukraine and southern Russia just 7,000-6,000 years ago.

And within a couple of thousand years it expanded in almost all directions, probably on the back of the early Indo-European dispersals (see here), to cover a massive range from Scandinavia to South Asia. It is the beast among Y-haplogroups.


The most common subclade of R1a-M417 in South Asia today is R1a-Z93, and, realistically, it couldn't have arrived there earlier than about 2,000BC. So much for the Pleistocene.

See also...

Y-haplogroup R1a and mental health

The Poltavka outlier

Yamnaya isn't from Iran just like R1a isn't from India

307 comments:

  1. After discovering R1a-M417 in Dereivka culture somebody should inform Kristiansen, Anthony and others that their theory about Corded Ware and Proto-Germanic coming from Yamnaya is obsolete.

    https://s26.postimg.org/7rt8bh12x/screenshot_292.png

    http://rootsofeurope.ku.dk/english/calendar/archive_2017/the-split-reconstructing-early-indo-european-language-and-culture/the-split-abstracts.pdf

    ReplyDelete
  2. There was no single M417 in Yamna? I can't believe it. :)

    ReplyDelete
  3. @Rob

    I've seen this map floating around online for years. No idea where it's from.

    I'll cite it when I find out.

    @Aram

    Too bad for Yamnaya (so far).

    ReplyDelete
  4. Why Iran has relatively low R1a? Iran was harder to conquer than India?

    ReplyDelete
  5. @Aram

    Why Iran has relatively low R1a? Iran was harder to conquer than India?

    Maybe at some level, but I think more importantly, Iran was basically the end point of the main R1a-M417 thrust as it moved from the steppe into Asia in a clockwise direction around the Caspian Sea.

    ReplyDelete
  6. Aram
    Iran had its own things going on, different "rhythms" . People certainly moved in and out of Iran . The SW became related to Uruk system whilst the north certainly had an invasion/ migration of Kura-Arax groups.
    Northern Iran is an entity of it said own, but seems to me to be related to the Proto-BMAC irrigafion agriculturalists

    ReplyDelete
    Replies
    1. ^that should say northwest Iran =KA, northeast BMAC

      Delete
  7. I see. Thanks. It would be interesting to see aDNA from Yaz culture. Is it feasable?

    ReplyDelete
  8. @Aram

    Why Iran has relatively low R1a? Iran was harder to conquer than India?

    The population of India has always been pretty high, much higher than Iran, allowing founder effects to occur and propagate pretty fast. I attribute the higher R1a in India to this- a few R1a paternal ancestors founding populations that then expanded rapidly

    ReplyDelete
  9. That rotation around the Caspian went at least as far as Mitanni before it ran out of steam. Perhaps the elite dominance was too weak by then to last long enough to cause language change.

    ReplyDelete
  10. R1a-M417 is displayed incorrectly. The village of Alexandria is located in the Kharkiv region on the border of the Ukraine and Russia (near a local maximum), but not in Kirovohrad region, west of the Dnieper. The problem is that the village of Alexandria is not displayed in the Google map.

    ReplyDelete
  11. while the suggestions are looking quite obvious and robust from Dave here , But I strongly suggest to wait for Indian data ...

    ReplyDelete
  12. @supernord

    The Longitude/Latitude coordinates for the R1a-M417 sample are provided in the Mathieson et al. 2017 spreadsheet: 48.66 33.10.

    If you put them into Google, you'll see that the pin is positioned where I put the R1a-M417 marker on my map.

    ReplyDelete
  13. R1a I wouldn’t say is a beast of a Haplogroup, but it is very widespread and numerous.

    ReplyDelete
  14. No doubt about it R1a invaded India.

    ReplyDelete
  15. If anyone still has doubts about the location of the Alexandria that this R1a-M417 comes from, it's shown on this map.

    https://i.pinimg.com/originals/57/33/3c/57333c0609d0e31b273fc437db3a83ab.jpg

    ReplyDelete
  16. Date from R1a-M417 obtained from the average temperature in the hospital only for the hole steppe Eneolithic 5000-3500. This date is not radiocarbon. Alexandria burial refers to the time when there existed Constantine culture, that is, to the middle of the 4th Millennium BC.

    ReplyDelete
  17. Mathison found in Google map not the same Alexandria. For Europeans there is no difference between Kharkiv and Kirovograd. Therefore Mathison was wrong.

    ReplyDelete
  18. @Nirjhar007

    Thanks Nirjhar for your input. I don’t understand your writing of why it’s a beast. Because it’s so common?

    ReplyDelete
  19. https://i.pinimg.com/originals/57/33/3c/57333c0609d0e31b273fc437db3a83ab.jpg
    It is correct but this is not your (by Mathison)48.66 33.10 on topic map.

    ReplyDelete
  20. R1a I wouldn’t say is a beast of a Haplogroup, but it is very widespread and numerous.

    It is 'the beast' as it is one of the most successful y-hg's , perhaps more than R1b overall .


    No doubt about it R1a invaded India.

    I don't think, it will turn out as many here is expecting to be, we still need aDNA from Proper India and surrounds .

    ReplyDelete
  21. Because it’s so common?

    Look at its expanse from the available aDNA we have so far and of course the modern ... it is so common cause it was so successful, from pre-historical times .

    ReplyDelete
  22. Mathieson et al's coordinates are NOT correct. See text of Mathieson

    Ukraine

    Alexandria (1 individual)

    An Eneolithic cemetery of the Sredny Stog II culture was excavated by D. Telegin in 1955-1957 near the village of Alexandria, Kupyansk district, Kharkov region on the left bank of the river Oskol.

    Find the Kupyansk district on Google map.

    ReplyDelete
  23. @ Nirjhar

    Thanks for the clear up. I understand now.

    ReplyDelete
  24. Yes it does seem to be a successful Haplogroup. Unlike my own Haplogroup that was conquered and subjected lol. We’re not so successful. ;).

    ReplyDelete
  25. @supernord

    I'll e-mail Iain Mathieson about this.

    ReplyDelete
  26. We fled into the mountains trying to escape the Indo European onslaught.

    ReplyDelete
  27. I always suspected that R1a is the true mark of the beast and we all know how that’s going to end. ;-)

    ReplyDelete
  28. OK, seems like commentator supernord was correct. The Sredny Stog II/R1a-M417 site in question is near the Russian border, not near the Dnieper. So I edited my map.

    https://4.bp.blogspot.com/-Je9MSxLd1GY/WcuzFWCF86I/AAAAAAAAGHY/1GJk6vQXAz8PHpEScVs4tIlyO511e2oCgCLcBGAs/s1600/R1a-M417_The_Beast.png

    ReplyDelete
  29. @Rob
    Re R1a1 map
    This from Underhill 2010 is close:
    https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&p=PMC3&id=2987245_ejhg2009194f1.jpg

    ReplyDelete
  30. @Aram
    "Why Iran has relatively low R1a?"

    They also appear to have lower steppe admixture compared to Central Asia and South Asia, low frequency of R1a probably correlates with that.

    Steppe admixture is highest in eastern/southern Iran among Iranian_Bandaris ~27% but as you move to West Iran, it gets lower as Persians are ~20% steppe admixed.

    http://eurogenes.blogspot.com/2017/04/zarathushtra-and-his-steppe-posse.html

    Based on above analysis, it's safe to say Iran was "Indo-Europeanized" by small band of steppe nomads. It is pretty obvious now that R1a/R1b correlates with spread of Indo-European language + steppe-admixture across Eurasia in Bronze-Age.

    ReplyDelete
  31. @EastPole

    Dear friend if you read the "Horse, Wheel and Language" book of David Anthony you will see that he clearly says that from the USATOVO lords and their patronage over the various peoples on Northcentral Europe emerged the Corded Ware culture and others alike!
    Hence from the Aryanisation of these areas various Indoeuropean dialects emerged indicating Proto-Germanic as the one of them

    ReplyDelete
  32. Ukraine HGs probably isn't the origin of R1a M417 or anything Steppe. On another note, based on mtDNA it looks like Catacomb had a big chunk of Ukraine HG ancestry. Maybe they were a mix between Steppe and Ukraine HG and maybe also EEF.

    ReplyDelete
    Replies
    1. According to ancient MtDNA finds, Catacomb Culture had some H6. I do wonder if this is H6a1a as Corded Ware Culture and Srubna Culture both had H6a1a. And MtDNA H6a1a followed yDNA R1a migrations into Northern & Central Europe from the PC Steppe during the late Neolithic and both are found in the Schnurkeramikkultur. I hope to find out someday IF MtDNA H6a1a was in the Mesolithic PC Steppe or in Epipalaeolithic Iran. MtDNA H2a1 was found in the PC Steppe before MtDNA H6. However, I feel H6a1a & H2a1 had a similar migratory path.

      Delete
  33. @Rob

    The local peak in West Asia is among the Kurds.

    @Sofia Aurora

    Ancient DNA shows that the Corded Ware horizon formed via the mass migration of steppe peoples. Anthony came up with the patronage angle probably to avoid criticism from anti-immigrationist colleagues at the time.

    ReplyDelete
  34. @Davidski

    I don’t get your motive for posting this. Haplogroup R1a is a beast? What does that make the other Haplogroups? You claim not to be racist and then you post this kinda stuff well your going to get negative reactions obviously.

    ReplyDelete
  35. @Richard Holtman

    R1a-M417 experienced a very intense and wide ranging expansion in a very short time, more so than most other human Y-haplogroups of comparable age.

    This makes it an unusual and special case among human Y-haplogroups, and, in the parlance of our times, a beast.

    There's nothing wrong with pointing this out, and I'm sure you'll be reading about it very soon in scientific literature, except I guess you won't see the word beast used.

    If you don't like this fact and you're psychologically affected by it negatively, then get another hobby. Or just get over whatever it is that is bugging you and discuss things in a reasonable way here like most of the rest of us.

    ReplyDelete
  36. Yes it does in fact bother me Dave. I’ll think about getting a new hobby or posting somewhere else. Your whole post to me is racist and offensive. So yeah. Until you can post something a bit less dark I’ll look for something else to do. Thanks for the tip.

    ReplyDelete
  37. @ AP
    Thanks,
    Thought it looked familiar

    ReplyDelete
  38. Nirjhar007 It is 'the beast' as it is one of the most successful y-hg's , perhaps more than R1b overall .

    https://4.bp.blogspot.com/_Qsl_MpdGv_o/S8CSRugDGfI/AAAAAAAAEQw/95WHvhZDnxY/s1600/y-dnaoftheworld2.gif seems like an OK first approximation of haplogroup frequencies, albeit without assuming that all 6.7 billion are males (which is a bit of a problem with their scaling !).

    R1a at something like 50% of Eastern Europe (292/2 = 146 million males * 50% = 73 million males) + 40% India (1324/2 = 662 males * 40% = 265 million males) gives around 338 million males... so basically around 10% of the world male population seems like a decent first approximation.

    ReplyDelete
  39. @MaxT:

    I don't know if we can say that Iran was IEzed by a SMALL band of NOMADS. In all likelihood, they were IEzed by a mediator Steppe-IranN/Chl hybrid population wave coming from the Oxus/Mughrab cultural urheimat where Avestan is thought to have been spoken. They would have been semi-sedentary, I'd think. Upon reaching modern-day Iran, steppe ancestry would be further diluted and, as Kurti is always quick to remind us, Mesopotamian practices heavily appropriated.

    In Europe, the analogy to this would be Unrfields, Unetice, and other IE-speaking Bronze Age cultures who formed around Southern Germany and brought their warrior cults to Italy, Iberia, and Occitania. These groups were all roughly ~50-50 steppe-LateEEF.

    ReplyDelete
  40. https://www.ncbi.nlm.nih.gov/pubmed/18942110

    "effect-size comparisons allowed us to detect an association of the haplogroups R2 (Cohen's d statistic=.448-.732) and R1a1 (d=.107-.448) with lower self-reported aggression mean scores in this population."

    ReplyDelete
  41. The Tiny southwestern state in India is shown as 5%, it is very inaccurate. There is a caste based distribution in India. The percentage is about 30% in my community and another community that I am aware of. India is not the same as Europe, as it is very egalitarian society. Indo Europeans implemented a more hierarchical society as a result causing the caste baste distribution of R1a. Upper castes account for about 30% of the population and there will be a higher distribution of R1a among that population. I believe the percentages will much lower in the other populace. It is annoying to look at the map when it is not completely accurate for India.

    ReplyDelete
  42. @Matt Thomas

    Fair point. From what I've heard, we'll probably see much more accurate R1a data and maps published for India very soon.

    ReplyDelete
  43. Hello all,

    I feel like I'm wandering into the extreme deep end here and if this comment is not appropriately placed, I won't be offended if you delete or move it.

    I have a question about r1A M420+ SRY10831.2- (full disclosure, I'm VERY new to all this and not a science person of any kind, so hopefully I'm using annotations right)

    It appears to me that I'm likely to fit the bill of someone who is positive for r1A M420 but not any recognized subclades. I'm basing this on ancestry.com raw data which I understand presents some sampling issues and I am maybe misinterpreting. I got here via a Promethease test indicating I had r1A, but then I've cross referenced my raw data with RS# and the isogg.org table and can't get beyond r1A-M420 as a terminal group. (Also negative for M513).

    Initially I thought this might be a sampling problem and I planned on doing 23andme or living DNA to get a more comprehensive test. (Again, very new to this, just learned what an r1A was about 3 days ago). However, when I poked around, I found that one of the other known M420+ SRY10831.2- test kits from the family tree dna database shares my surname (Beckett). See https://www.familytreedna.com/public/R1Asterisk/default.aspx?section=yresults

    I'm an American and can, with some uncertainty, trace my Beckett line back to the late 1600s to a guy named Humphrey Beckett who came from Hampstead to Maryland.

    It looks to me like my r1A* paragroup is the object of some academic study. I would really like to talk to someone knowledgeable about it to fill in some (substantial) gaps in my knowledge. Please? (And TYIA).

    ReplyDelete
  44. @Anthro Survey

    In all likelihood, they were IEzed by a mediator Steppe-IranN/Chl hybrid population wave coming from the Oxus/Mughrab cultural urheimat where Avestan is thought to have been spoken. They would have been semi-sedentary, I'd think. Upon reaching modern-day Iran, steppe ancestry would be further diluted and, as Kurti is always quick to remind us, Mesopotamian practices heavily appropriated.

    Do you think these hybrid population carried J2? going by R1a/R1b frequency in Iran, these steppe clads do not seem to have had founder effect in Iran like it did for Europe and SCAsia and it seems very unlikly that whatever steppe admixture came to Iran were J2, even if they were admixed, since R1a frequency is also high around Oxus/Margiana complex.

    @AP
    Re R1a1 map
    This from Underhill 2010 is close:


    https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&p=PMC3&id=2987245_ejhg2009194f1.jpg

    Interesting map, high R1a frequency in Middle East seems to be in Kurdish-speaking region?

    ReplyDelete
  45. @Jack

    You'll have to spend more money on a more comprehensive test. There are different options that you can ask about at forums and online groups dealing with R1a.

    ReplyDelete
  46. @Davidski
    Other haplogroups could also be denoted as "beasts", Like Haplogroup O in East Asia, Southeast Asia and India and E1b1a in Africa and Q in the Americas.
    Beastly behavior is not unique to R1a1-M417

    ReplyDelete
  47. @Roy

    All of the Y-haplogroups you mention are older than R1a-M417 and had more time to expand.

    ReplyDelete
  48. @ Jack

    Of course, as Davidski said to you, you should spend more for knowing your Y, but very likely you belong to the Western European R1a-M420-YP4132 cluster, and you may know that for certain just testing this SNP for only 18 dollars c/o www.yseq.net.

    ReplyDelete
  49. @Davidski
    I don't mean to be contrarian, but your statement is not accurate:
    E-U290 and E-U174 are dominant in the Bantu expansion and are pervasive throughout SSA--E-U290 has an expansion time of 4700 bp and U174 has an expansion time of 5200 bp. Also O-Y15976 which ranges from Pakistan to Vietnam to Korea has an expansion time of 5300 bp. A lot was happening across the globe around 2000 to 3000 BCE with major demographic expansions. Many beasts or much transitioning, take your pick.

    ReplyDelete
  50. @Roy

    I wouldn't say there were many beasts based on the relatively deep phylogeny and/or limited geographic range of most modern lineages, but rather a select few beasts like R1a-M417 in different parts of the world.

    ReplyDelete
  51. @ Jack

    But you cannot be negative for M513, because this SNP is upstream YP4132. In this case you would be the first R1a* found so far in the world, thing not impossibile coming you from Northern-Western Europe, but have you any other data? Some STRs, also Y12? My address is gioiellotgnn06@gmail.com

    ReplyDelete
  52. @Davidski
    I agree with your caveat. R1a-M417 like several lineages across the globe had a rapid range expansion and demographic expansion during the Bronze Age. The term "beast" of course is your rhetorical flourish for accounting for these phenomena. I guess you are using football terminology?

    ReplyDelete
  53. Yes, it's a football (soccer) term of sorts for players who had a great game.

    ReplyDelete
  54. In fact Beckett is a different haplotype as to the other R1a-YP4132 and is tested only for
    119339 Beckett R-M173 M173+, M343-, SRY10831-

    and the FTDNA (its experts) is frequently wrong in its test.
    119339 Beckett England R-M173
    14 24 14 10 12-12 12 12 12 13 13 29 19 9-9 11 11 23 14 20 30 15-15-16-16 11 12 19-22 15 16 18 16 39-39 13 11 11 8 15-16 8 12 11 8 11 11 12 21-22 15 10 12 12 14 8 14 24 22 13 12 11 12 11 11 12 12


    ReplyDelete
  55. @Davidski
    Thanks for the clarification! In my neck of the woods, in California, we might term it as "male chauvinist pig" rather than "beast", but of course that is likewise rhetorical. That term could apply to the Bantu and Han Chinese expansions, as well.

    ReplyDelete
  56. @ Davidski


    “Roy King has left a new comment on the post "The beast among Y-haplogroups":

    @Davidski
    Thanks for the clarification! In my neck of the woods, in California, we might term it as "male chauvinist pig" rather than "beast", but of course that is likewise rhetorical. That term could apply to the Bantu and Han Chinese expansions, as well”.


    Next WW3 soon to come. It is important that R1a and R1b are together, but perhaps Putin is hg. N…

    ReplyDelete
  57. @Gioello
    More like WWW-World Wide Wrestling, than WW3.

    ReplyDelete
  58. Roy, but it is so difficult to write "Gioiello" instead of "Gioello"? I know tha Americans don't pronounce /j/, but we do it. Hope that it is due to your Language...

    ReplyDelete
  59. Not sure what the gene variant is for annoyance with self-righteous hyper-prickly hair-trigger virtue-signalling but I think I have that variant.

    ReplyDelete
  60. @David and others

    How sure are we that the 5th MN in German CW is local uptake? Can we find something to determine if it wasn't actually admixture like Alexandria has?

    ReplyDelete
  61. Interesting little comment there, Mr. Tognazi: In the coming WW3, we Jews will offer you a nice permanent beat down (figuratively speaking, of course ;) or should I say "nuclear meltdown" :) ) because we have a pretty decent percentage of R1a-M417 and R1b-M269, with R1a-Y2619 being the single biggest Ashkenazi Jewish clade at 6%. First off, we need "practice" and this blog is an excellent place to start: (Cheers in the background!)

    ReplyDelete
  62. What I find so remarkable about R1a isn't just its expansion, but also how few living relatives from prior to that expansion we can find. R1b-M269 has relatives at least in the not too distant past. The post expansion R1a seems to have nothing related to it alive anywhere today.

    ReplyDelete
  63. To a certain degree the Indo-European expansion reminds me of the rapid early Islamic expansion, which raises the question to what degree these early Indo-Europeans were already active in the areas they later conquered. From the early Iron Age on, Arabs are mentioned as some sort of war like people by most annals regarding the Fertile-Crescent. So when Islam burst out of Arabia the already present Arabs of the Fertile-Crescent contributed to the rapid expansion of Islam. Plus, a key feature of both groups is high mobility and a nomadic way of life. So I wouldn't be surprised if these early Indo-European groups already knew what they were going to hit in advance.

    ReplyDelete
  64. What I find remarkable about R1a are strong links in language, poetry and religion between Slavs, Greeks and Indo-Iranians which correlate with R1a expansion. Looks like R1a were very religious people, poets and philosophers. They influenced Eastern Europe and India very much not only genetically.

    ReplyDelete
  65. @David: I think we can add to the list some truly remarkable expansions of Y haplogroups:

    J-FGC11 tMRCA 4000 ybp, found in Bronze Age Sidon c. 1650 BCE, clearly associated with the Amorite Expansion at 2000 BCE
    J-Y4349 under J-FGC11 tMRCA 3100 ybp, which at 1100 BCE dates to the Late Bronze Age Collapse and the domestication of the camel in Arabia
    I-S17250 tMRCA 1850 ybp, 165 CE, corresponding to the Antonine Plague, which was perhaps the first incidence of smallpox in Europe, and the expansion of the Veneti (aka the Sclaveni)
    E-M81 tMRCA 2300 ybp, and particularly its main subclade E-PF2546, tMRCA 200 BCE, which would correspond to the approximate founding of the Numdian Royal Dynasty by Masinissa (c.238 BCE - 148 BCE) son of Gaia, the chief of the Masylii. He is known to have settled the nomadic Numidians, and with the defeat of the Carthaginians by Rome in 146 BCE, this caused a rapid population expansion among the Berbers. This expansion was so thorough that today, E-M81 dominates among most North African populations with its only rival being the J-Y3439 subclade J-Y5323, brought to North Africa by the Bani Hillal and Bani Sulaym Arab Bedouin tribes in 1001 CE.

    ReplyDelete
  66. Of course, the best haplogroup is I. The OG Europeans. Ice age , dinousaurs, comets, and farmers and herders, seen it all.
    Euroe's big boys.

    ReplyDelete
  67. @Rob

    I-newby! C1a saw much more. Hell, they even shook hands with the Neanderthals.

    ReplyDelete
  68. 'A beast of a' is just an expression meaning 'huge'. Well it is in British,,Irish and apparently Australian English. It sure about the US and Canada.

    ReplyDelete
  69. Can we call R1a the Beastie Boys then?

    ReplyDelete
  70. @ Epoch
    Of course I'm joking. We all know dinosaurs aren't real- they're a communist conspiracy

    Seriously though, modern Europeans C1a is from Anatolia, not La Brana

    ReplyDelete
  71. R1a is big but it's hard not to notice that it is hugely outnumbered by P312 in what was considered the best farming land in Europe by early historians (most of which the Romans annexed) It tends to be highest in Europe in areas the ancients saw as marginal with brutal winters. well that is the modern pattern but it's not yet clear how it ended up that way.

    ReplyDelete
  72. MaxT
    "Based on above analysis, it's safe to say Iran was "Indo-Europeanized" by small band of steppe nomads. It is pretty obvious now that R1a/R1b correlates with spread of Indo-European language + steppe-admixture across Eurasia in Bronze-Age. "

    Far too simplistic thinking. A trait many commentators here seem to have. Especially the "it's safe to say" part.

    Anything it's safe to say that the ancestors of the West Iranics did not come straight out of the Steppes. It was not a sprint, it was a relay run.

    And from my knowledge of history and the historic records. THere wasn't any "dominance" to begin with. It's not a little Steppe group ruling over a bigger group of locals as some people make up in their fantasy. It was a made package when they already reached the Western part of the Iranian Plateau, because they didn't come out straight out of the Steppes but from Northeast part of the Iranian Plateau. possibly absorbing only 30% of local genes. Western Asia was pretty much far advanced and this is probably the reason why Indo Europeans couldn't expand as good there as they did in Central/East/North Europe or South Asia.

    ReplyDelete
  73. Rob

    Of course, the best haplogroup is I. The OG Europeans. Ice age , dinousaurs, comets, and farmers and herders, seen it all.
    Euroe's big boys.


    Makes sense indeed :) .

    ReplyDelete
  74. Kurti,

    I still think its a bit early . South Asia was also quite advanced , IVC is one of the biggest and advanced civilization of Pre-history . And you and I will agree with this suggestion from
    The Oxford Introduction to Proto-Indo-European and the
    Proto-Indo-European World
    ,p.462 :
    The archaeological evidence for an expansion from the steppelands across historical Iran and India varies from the extremely meagre to total absence: both the Anatolian and the Kurgan theory find it extraordinarily difficult to explain the expansion of the Indo- European languages over a vast area of urbanized Asian populations, approximately the same area as that of Europe. .

    We will have to keep looking for data . Our objections regarding Steppe Model was not due to imagination , but by following facts ...

    ReplyDelete
  75. I don't want to be off-topic here, but for better visibility I'll drop the hint that I've just added some further thoughts on the comments thread on "Modern-day Greeks & Italians vs Mycenaeans" - just in case anyone cares.

    ReplyDelete
  76. @Gioiello, thank you for the response. I emailed you.

    I said that I'm negative for M513 because my data shows rs17222573 A;A. However I'm rs17250535 A;A which is why I believe I am R1a-M420. Again, I'm pulling from raw ancestry dna data. And my own methodology may be very unsound (cross referencing the RS#s with the ISOGG table). So all the usual caveats apply.

    ReplyDelete
  77. Lots of interest in this post; almost as much as in posts about new ancient DNA papers. Hundreds of hits just from Facebook and Twitter.

    ReplyDelete
  78. @Davidski

    It’s getting a lot of attention because it’s controversial....there were a lot of successful expansions as mentioned in previous posts. Besides numbers or numerical superiority means nothing anyway. The strong man stands alone.

    ReplyDelete
  79. @ Jack

    Great! You are R1a-M420+/M513-.

    This is a new SNP, you are positive for and I am negative, not what you believed
    Sample: #YF02873 (R-FGC24408)
    ChrY position: 17222573 (+strand)
    Reads: 16
    Position data: 16T
    Weight for T: 1.0
    Probability of error: 0.0 (0<->1)
    Sample allele: T
    Reference (hg19) allele: T
    Reference sequence (100bp): GCCCCTCCCCACATCAAGCTCCAGCTTCCCAGGTAGATCTCAGACTGCCG
    T
    GCTAGCAGTGAGGATTCCAAACCAATGGACCTTAGCTTGCTGGGCTCCGT
    (17222522-17222623)

    If I’ll demonstrate once again that what is the Isles was before in Italy, my victory will be complete.

    ReplyDelete
  80. Strengths in numbers, there is nothing special about it. China is the most populated country in the world. Are they the most successful or beasts? LMAO!!! No.

    ReplyDelete
  81. India is second in population are they more successful than the US? Let’s have a look. No. In fact some Scandinavian countries with a low population have the highest educational standards in the world. So your expansion theory is flawed. Poupulation has nothing to do with success. China and India are not the most powerful countries in the world despite being more populous. Remember it’s not smartest who survives nor the strongest but those who can adapt to change that survive and prosper the most.

    ReplyDelete
  82. @Davidsky,
    Does not matter how many different forms I try to state the argument that you will delete it, wont you?
    It speaks Volumes, does it not?

    Is there a way you will allow that argument to be made?

    ReplyDelete
  83. @Olympus Mons

    Your posts are too juvenile for me to let them appear here. If you want to argue something, make sure you actually have an argument and don't sound like a 12 year old when you're making it.

    @Richard Holtman

    You need clam down. Last warning.

    ReplyDelete
  84. You need clam down. Last warning.

    Meant to say calm down. But also clam down while you're at it Richard.

    ReplyDelete
  85. @Aram said...
    Why Iran has relatively low R1a? Iran was harder to conquer than India?

    This could be because India developed a caste system. Higher caste males have a better chance of mating.

    This pattern is also true for R2, J2 and to a certain extend L.

    R1a seems to have mixed with R2, J2 to form a higher caste in India.

    I am no expert on this subject, but will be an interesting subject to research.

    I suspect R2, J2 had their roots in Indus valley/ Iran neolithic. L formed the bulk of the population.

    R1a seems to have absorbed R2 and J2 into the higher castes of India.

    ReplyDelete
  86. Paul, Beckett is very likely linked to the Beckett in the R1a* project, who in fact has a different haplotype from the other R1a-YP4141 from the Isles, but this Jack did only Ancestry. com, and I have many doubts as to how they tested like Geno.2.0. They don't indicate the Y chromosome but 23, 24, 25 (?) chromosome. etc, thus it is difficult to me to understand their data. And it seems that Jack is negative also for M173, thus I have many doubts. But Beckett of the R1a* project merited to be tested for at least a Big Y or better an Y Elite or some SNPs c/o Yseq. I'd ask Jack to do some of these tests.

    ReplyDelete
  87. The choice of gradient divisions for the chart is giving a misleading picture regarding the frequencies in West Asia. I suspect the author used Grugni et al. for their Iranian figures, where the Kurds were 20.3% R1a1a and the Azeri Iranians were 19% (a 1% difference is enough to give the false impression of a hotspot around Kurdistan here). Older studies corroborate those frequencies (f.ex. Azeri Iranians were also around 19% from Quintana-Murci et al. from memory). It looks like NW Iranians are generally around 20%, although this doesn't apply with the Caspian ethnic groups.

    Armenians generally score less than 10% (Iranian Armenians were 2.9%). It appears the NW, NE and SE are the higher frequency areas, generally speaking. The Iranian average is 13.9% per Grugni once more.

    Why the frequency is lower among Iranians than Indians is a fairly straightforward question; by whatever mechanism, there is a much stronger paternally-driven Y-founder effect in the Subcontinent. It should be noted that steppe-derived mtDNA is more frequent in Iran than in India. That might shed light regarding the nature of said mechanism (more folk migrations in Iran vs. more warrior bands into India?).

    ReplyDelete
  88. @Creative,
    "To a certain degree the Indo-European expansion reminds me of the rapid early Islamic expansion, which raises the question to what degree these early Indo-Europeans were already active in the areas they later conquered. "

    I doubt any of them lived in EEF/WHG Europe before 3000 BC. Anyways, I have had some of the same thoughts on Steppe/Indo European invasions (I think invasion is accurate). It seems they war-like people who intentionally rapidly invaded and settled huge swathes of land within a few generations, kind of like what Muslims did in the Middle East.

    Usually, when we think of pre-historic gene-flow we think or a gradual, uninteional, organic process. But that's not what how Steppe/IEs spread into Europe at all. It was all planned in a sense.

    For example, the R1b L21 tribe/clan/nation that invaded Britain without a doubte knew what they were doing. We can know with certainly that at somepoint between 2500 and 2400 BC, chiefs from the R1b L21 nation sat around a camp fire or hut or whatever and said something like "Let's, go make that giant island our home." and then 1,000s of them sailed on boats to Britain.

    ReplyDelete
  89. @David - Could we get that crazy WW3 comment taken down too?

    @Mike - Yah, "beast" just means huge here too.

    Can I call these haplogroups skookum instead though? In the Pacific Northwest (British Columbia, Washington, Oregon and Idaho) it means strong or good or monstrously strong/good. Great word.

    ReplyDelete
  90. Most crazy comments can stay up, so that people know who the crazies are.

    ReplyDelete
  91. "Why Iran has relatively low R1a? "

    suitability for cattle? lots of rain but not monsoon levels?

    iran rainfall
    http://file.scirp.org/Html/4-4700152/de67d26a-c4da-4270-a1b7-11e1569d9efa.jpg

    india rainfall
    http://static.ibnlive.in.com/ibnlive/pix/ibnhome/india-rainfall-map-310715.jpg

    ReplyDelete
  92. @Davidski
    As a psychiatrist, crazies never ever know themselves who they are.

    ReplyDelete
  93. I wouldn't say r1a or r1b to be low in Iran. Recall that these groups are of steppe origin, nomadic, and merged into preexisting populations. How high a rate do you expect?

    ReplyDelete
  94. @David - Gotcha.

    @Grey - Not sure what the mystery is here anyways. Every language shift has some degree of migration and some degree of assimilation. With the Iranians there was more assimilation and less migration than in India apparently. Is there anything more to worry about even? I don't find it all that surprising - much of the Iranian plateau seems to have been Indo-Europeanized gradually and relatively late. The Achaemenids used Elamite as one of their official languages too.

    ReplyDelete
  95. @mike, you are right. It looks like p312 swallowed former lbk territory and cw territory. Now, we need to know where they originated and how this happened.

    ReplyDelete
  96. Here's a recent archaeological paper about an Iron Age grave in what is now Iran, with some background about the Indo-Europeanization of the region. Open access...

    A palimpsest grave at the Iron Age cemetery in Estark-Joshaqan, Iran

    ReplyDelete
  97. @David - not sure that helps us much in terms of figuring out the demographic weight of the gradual Indo-Europeanization of the region though. How many people came with this cultural package? Only DNA is going to answer that effectively. Especially tough without DNA in a place like the Iranian Plateau where nomadic pastoralism had been a way of life for thousands of years prior to the Iron Age.

    ReplyDelete
  98. What do people here think about talking about haplogroups. Do you think it is racist to talk about Haplogroups ? I was talking to a Chinese guy and I was talking about DNA testing and casually mentioned my Haplogroup and how the distribution was shared in South Asia and Europe. He accused me of being a very Racist individual. What are your guys thoughts on this ?

    ReplyDelete
  99. @Ryan

    Makes sense, more ancient DNA samples are needed to see how demographic change took place.

    ReplyDelete
  100. @Matt Thomas

    These days, it's very easy to be accused, or at least suspected, of being racist, especially for Europeans and individuals of European origin.

    In fact, I'd say that the concept of racism has been widened to such an extent in recent years that it's fast losing its meaning, because when just about everyone is racist, then it makes no difference.

    But if you're into population genetics and genetic genealogy, then this really sets off the alarm bells for many people, because they've been indoctrinated into thinking that differences between human populations at all levels are so trivial that they practically don't exist.

    So not only are they adamant that human races don't exist, which is a reasonable position, but also that human population structure doesn't exist, which is not a reasonable position. And if you argue with them that population structure does exist, and is often significant, then you're likely to be branded a racist.

    ReplyDelete
  101. @Matt Thomas,

    I agree with what David said but racism easily mixes with a discussion of genetics. Maybe not really racism but ethnocentrism. I know first hand because I was definitely pretty ethnocentric when I first started getting into genetics. But what David said is true if you discuss inherent differences between human population at all in the 21st century there's good chance you'll be accused of being racist.

    I've had four teachers declare race doesn't exist. They say it is only skin-deep which is an argument that defeats itself because skin color is inherited genetically and therefore it results from a inherent, genetic, biological difference.

    In a hard to believe way the "race doesn't exist" thing derives from Marxist thinking and communism. Race to some is just a social class created in order to privilage white people. White people to the radical and minority in America the equivalent of the Aristocracy of 19th century Europe. That's why SJWs say things like "White Privlidge." What they want to do is remove the idea of race because they believe it creates social inequaility just as tradtional Marxist want to remove social class and make everyone economically the same.

    I think it's really important to be aware of this, much of the Social Justice stuff is Socialism in disguise which is creating more division, race/class politics in America.

    ReplyDelete
  102. @Samuel Andrews
    Having had a cross burned on our lawn and a rock thrown through our window when I was a teenager, only because we were a Black family moving into an all-white neighborhood (mother a math professor, father a physician), I find it difficult to attribute "racism" to Marxist ideology. Also, later, with the advent of sophisticated population genetics, finding out that I and all my family are very mixed--each of us with admixture across the globe--skin color is a poor proxy for genetic heritage.I rather view individuals as a different category of description from culturally derived groups: Black/Hispanic/White/Native American. Race is not equivalent to class, but in my opinion, one of the most socially constructed categories around--valuable for studying interpersonal interactions, not helpful in understanding population genetics.

    ReplyDelete
  103. @Roy King,
    "I find it difficult to attribute "racism" to Marxist ideology."

    Lol, yeah no way. That's not what I think at all. Racism is very real, was very real, and has had a huge impact on Black Americans. People who want to say Black Americans and White Americans are born with the same opportunities or past racism has no impact on America today are living in fantasy land.

    What I was saying is much of the social justice stuff derives marxism and isn't good for America. It creates more division and too much emphasis on class differences (race, gender, sexual orientation). To them white=aristocracy, non-white=peasants.

    "Having had a cross burned on our lawn and a rock thrown through our window when I was a teenager, only because we were a Black family moving into an all-white neighborhood"

    Super sorry about that. To me it shows racism was just common belief in America before recently and still impacts the way Americans think about race. My Dad grew up around some confederate flag wearing racists.

    ReplyDelete
  104. @David & @Samuel Andrews:

    Let me respond:
    I (and those who agree with me) don't say that variation doesn't exist among humans. That's nonsense.

    What we do say is that human variation is more complex than the traditional categorization of "Races" - of which there are many such categorizations, e.g. the "Semitic Race" or the "Jewish Race" - and that almost all individuals have a mix of these ancestral components.

    Consider, for example, that the Irula don't really represent the actual ancestral "ASI", but that is truly represented by the incredibly isolated Onge of the Andaman Islands. We've only been able to tease out these ancestral components through aDNA, as everyone here should be aware.

    Certainly, it seems pretty obvious that the Mozabites won't be "pure" North African Hunter-Gatherers (as represented by the IAMs) because they have Neolithic European (and later) admixture. The Bedouin B don't represent the Natufians, even though they have a decently high percentage of this "Natufian" component, which in turn is itself a composite.

    There is much to be learned from regional variation. However, the perceived "Racial classifications" we always see have no real correspondence with this ancestral variation.

    Also, much more critical to human health, are variations in the chr6 HLA region. We see that the same HLA antitypes (haplogroups, as it were) such as "Archaic" HLA-B*51:01 and HLA-B*27 are found all over the world, alongside others who they diverged from before the start of AMH. I've also seen remarkably that these two potentially pathogenic HLA antitypes went to high frequency among the Early Neolithic Farmers, regardless of their other ancestral components.

    So what we object to here is not talking about human variation, but rather, the miscategorization of human variation according to what we know now, and the ignoring some important kinds of genetic variation which are not superfically apparent.

    There's nothing "racist" about teasing out ancestral components. On the contrary. The problem is, that "Race" refers to a certain set of arbitrary categories that are just not backed up by science. (There is no such thing as "Negroid" because Africans of all kinds are more genetically variable among each other than between any other group on Earth.)

    So if anyone is interested in the real, genetic, and archaeologically attested forms of human variation, and the nuances revealed by admixture calculators and PC and MDS plots, then this is the kind of study and acknowledgment of human variation that counters traditional "Racism". I think most people here are truly interested in this kind of study of human variation, and not the old-timey simplistic "Three (or Five or Seven) Great Races of Mankind".

    ReplyDelete
  105. David, thanks for letting this discussion continue

    @Open Genomes,

    I hear you.

    ReplyDelete
  106. People here say they dislike the "Regressive Left" and "Political Correctness". Fair enough: One major characteristic of the Regressive Left is a kind of "essentialism" that reduces people to categories innate categories that they cannot change.

    The biggest one of course is "Race".
    People are either "Persons of Color" (or is it "Colored Folks"? >:) ) or "White". That's it.

    Imagine a K=2 where Turks and Armenians cluster together with Mbuti and Papuans, but Anatolian Greeks don't cluster with Turks, they cluster with Saami.

    If people here oppose the "Regressive Left", they you all should be glad about a look at human variation that doesn't cluster people into K=3 (or K=3) and allows for multidimensional complexity. This is something that both the "Regressive Left" and the "HBD Alt-Right" hate with a passion.

    Do you want to help put an end to this K=2 or K=3 madness, where everyone is 100% of a certain component, regardless of their actual ancestry? The "One-drop Rule", with "White" being the unadmixed "purest" on both sides. If so, then you are on the side of Science and not "essentialist mythology. Did you ever think of "Race" from that perspective?

    ReplyDelete
  107. @Samuel Andrews

    I think that people who abhor the "Regressive Left" and who are interested in Science and genetics, but who don't think of themselves as traditionally liberal, can be valuable allies of those on the liberal side who also abhor the "Regressive Left" and their "essentialism" in regard to "Race".

    We are not on "opposite sides" in this battle.
    This traditional "Left-Right" spectrum is breaking down real fast, and explaining and presenting evidence for a new paradigm of human variation ("ancestral components" and "admixture" vs. "Races") is a good way to achieve this common goal.

    Just remember, in the US (and elsewhere), "Race" is conflated with "ethnicity", "culture' and even "caste". (e.g. People with slave ancestors in the US are considered "Black", regardless of their actual admixture.) That doesn't mean that these groups don't share a common heritage and culture, or that Racism (or more accurately, "Colorism") doesn't exist, or that it isn't true that you're more likely to be stopped by the cops in the US based on your 4 alleles in just two SNPs, but this isn't biology. These are just "social constructs" as they say - but ones that mean something else than what people think they mean.

    We can work together to separate genetics and biology from these social ideas, which just aren't based on Science, but culture.

    If you think about it, really what both the "Regressive Left" and the "Alt-Right" have in common is this "unchangable essential K=2".

    Here's the chance to change that, together!

    ReplyDelete
  108. David, talking of 'beasts', what is the ultimate origin of R1b-L21?, the main 'British Isles' haplogroup. Surely, its modern preponderance in the USA and elsewhere entitles it to 'beast' status, not in the least because the likely founding population on the Isles was exceedingly small.

    ReplyDelete
  109. @mickeydodds1

    L21 might have been born in a Beaker population in Central Europe. But I think a more interesting question at this point is where L51 came from exactly. I suspect we'll learn the answer soon when a few more ancient male samples from the Eneolthic and Bronze Age Pontic steppe are published, but nothing's certain until then.

    In any case, L51 and L21 are both beasts, but perhaps not in the same league of beastliness as M417, simply because in terms of the pace of spread, geographic range, and sheer numbers, M417 still wins out.

    Keep in mind, for instance, that Russia is the biggest country in the world, and India one of the most populous. So, for whatever it's worth, it really is very difficult for many Y-haplogroups to compete with M417.

    ReplyDelete
  110. Davidski, perhaps you should know the beast in the Alps...

    R-L389 L389/PF6531 * L388/PF6468 formed 17100 ybp, TMRCA 15600 ybp
     R-L389*
     R-V1636 BY15342 * BY15367 * BY15338+51 SNPs
     id:YF10512BGR [BG-01]
     id:HG00640PUR...
     R-P297 YSC0000269/PF6475/S17 * PF6498 * L752/PF6483+34 SNPs formed 15600 ybp, TMRCA 13300 ybp

    Thus YF10512 and HG00640 have 54 SNPs in common. P297 separated from L389* after 37 SNPs.
    15600 – 13300 = 2300
    2300 : 37 = 62 years each SNP
    54 x 62 = 3348
    15600 – 3348 =12252
    We may discuss this calculation, but it seems that the expansion of R-L389* subclades had something to do with the Younger Dryas.

    I wrote in another post here in the YFull page: “The SNP V1274/7613234 (G>A), assigned to Mangino (Italy) from FTDNA, belongs also to Puerto Rican HG00640 but not to YF10512, thus separating the Western European R-L389 from the Italian Refugium from the Caucasian haplotype:
    REFSEQ G
    HG00640 R-L389* A
    YF10512 R-L389* G”
    Thus these two samples in the YFull tree so far belong to the two separated clusters: the Caucasian and the Western European one, which is the ancestor of the subclades of R1b1 for its YCAII=18-23 and not 23-23.

    ReplyDelete
  111. I think that it is possible that the early Achaemenid elite was R1a and mostly steppe derived (given that they called themselves 'Aryan' over and over again), more similar to modern south Central Asians like Pamiris, Tajiks and Pashtuns than to modern Iranians from the country of Iran.

    ReplyDelete
  112. Of course this Western cluster (with at least 4 different haplotypes present in Italy) isn’t the ancestor of the R-P297* cluster ancestor of all the subclades and born 15600 ya as to YFull, but very likely this R-P297* was born there where we have more variance instead of there where we have only one derived haplotype, and the sample from Bulgaria may demonstrate that the origin was Westernmost the Caucasus, not excluding that also this haplotype may have migrated to central Asia and come back with Turks. We’ll see from other samples.

    ReplyDelete
  113. Ryan said...
    "@Grey - Not sure what the mystery is here anyways ...snip... With the Iranians there was more assimilation and less migration than in India apparently."

    that's the mystery - not an earth shattering one for sure but interesting to some.

    "I don't find it all that surprising - much of the Iranian plateau seems to have been Indo-Europeanized gradually and relatively late."

    one possible explanation is the Iranian plateau is too dry for cattle - sheep and goats only (according to the interwebs yesterday).

    if so the general I-E pattern might be large scale replacement in land suitable for cattle while in adjacent unsuitable regions it's either elite conquest or indigenous survival as tributaries.

    (which reminds me of the list of tributary contingents that made up the Persian army at Gaugamela)

    ReplyDelete
  114. Matt Thomas said...
    "What do people here think about talking about haplogroups. Do you think it is racist to talk about Haplogroups?"

    I think a lot of people want their native group or home region to have been a big deal in history and that motivates people to find useful and interesting info - so on a purely practical basis I don't care as long as it's not too obsessive.

    In terms of social implications, following the logic of genetics might be a bumpy ride but the end result has the potential to be immensely net beneficial imo.

    ReplyDelete
  115. @ Davidski

    I don’t think it’s a competition or competing here. Was R1a successful? Absolutely 100% that’s just reality. However they wouldn’t have done so well if the seeds already there like Neolithic culture’s that R1a built upon were not there. It’s like a trigger effect one is not possible without the other. That’s why European’s are a mixture of EEF WHG and ANE. It’s history. And should remain untouched and without bias. As Soon as you elevate a Haplogroup to me it shows ignorance and lack of understanding about ancient European history. The spread of farming if you look at a map is pretty extensive but we don’t go around bragging about it. That’s why you’ll never see your work get published or any serious attention. No one is going to publish a paper with “ R1a is a superior Haplogroup “ it just won’t happen. Why? Because although it was a very successful Haplogroup people realize that it is not superior genes but a foundation already in place that made these migrations able to happen.

    ReplyDelete
  116. @Matt Thomas

    No it’s not racist to talk about Haplogroups. It becomes racist when people try and say that one Haplogroup is inferior to the other. That’s racist. And there’s no place for it in science.

    ReplyDelete
  117. @Richard

    I don't want to blow my own horn too much, but since you broached the subject, let me assure you that this blog does get some very serious attention and it has an impact. Enough said.

    But I think you missed the point of this little blog entry about R1a. The point is this...

    http://eurogenes.blogspot.com.au/2017/09/the-beast-among-y-haplogroups.html?showComment=1506599286529#c4958050278052417317

    ReplyDelete
  118. @Matt Thomas

    I completely understand and am sympathetic to people trying to elavate or promote their Haplogroup. It’s a natural part of being human. We all want to feel superior. However it becomes a problem when handling science. I don’t blame Davidski at all. He’s obviously in Haplogroup R1a and is proud of it. Good for him. That’s not the problem. The problem isn’t pride here. It’s when you discriminate or make exaggeration’s then it becomes a problem.

    ReplyDelete
  119. @Matt Thomas: What do people here think about talking about haplogroups. Do you think it is racist to talk about Haplogroups ?

    No not racist, but I don't grok a lot of the interest in them. They don't really carry any alleles which affect phenotype* in a major way, and they don't tell you anything much about which populations your ancestry was evolving in. They can undergo these quick expansions and population switching due to founder effects.

    It's cool to understand them as another tool to understand how and when populations *got* related, but they don't tell you much about how much populations *are* related, or how you as an individual are related to others and to ancient cultures.

    Particularly, the whole thing where it seems like some men identify with some random ancient 2,000 BC guy, and think they're particularly related to this person and not the other streams of their ancestry because that's the one that managed to survive the whole random process is weird to me. Or where some guy with R1b would think he's genetically closer in a meaningful way to a steppe culture than someone from the same population with I1 or something.

    *at least, so I strongly expect y haplogroups are phenotypically unimportant, though doing a bit of GWAS on sequenced y chromosomes and UK Biobank scale 500,000 strong populations (males vs other males, males vs related females) might be worth doing just as a way of completely testing this stuff to death and checking out the unlikely hypothesis to be sure.

    ReplyDelete
  120. Two sides to a story and freedom of speech,

    There are always two sides to every story. So it really depends who is in control of the narrative; and who is willing to stand up for freedom of speech and freedom of knowledge. For example, here are some populations to compare,longevity infant mortality and living standard, crime rates-some are in isolated islands while some are mixed/cosmopolitan examples.
    Haiti- Has it achieved a higher standard of living compared to beginning of its 200 year oppressive colonial rule.Have they set out in their quest for a better society and abolished child slavery?
    Japan- Do they have a higher standard of living, lower homicide rate, longevity rate, even after being influenced colonial rule and nuclear ware fare waged against them?
    What about cosmopolitan Venezuela and its abundant oil reserves and gun control policy?How does its standard of living and crime rate and longevity- compare with the above two genetic isolates?
    What about IQ difference among Ashkenazi and Sephardic Mizrahim- Does it exist? If so why even though they all groups are brought up in the same ethno-religious principles households and plot the same on PCA plots?
    Or how about a simple [male/female]demographic/genetic study on those who pass with flying colors and those who drop of Harvards Math 55 program? Can we see those results?

    As for the Beast in R1a- that two has 2 sides, and depends on who controls the narrative/blog .R1a-Z93 was not so successful in it's original birthplace and Arkaim-Sintashta and surrounding regions.
    Despite having fortified complex's with moats, choice weaponry, war chariots and large funeral feasts with many allies have little R1a-93 in the current maps . Look/compare modern frequency of Iranian branch R1a-93 in Bashkirs[Arkaim Sintashta region]and compare to well known former Iranian regions that still have Iranian place names and rivers[ in Ukraine]-Dnieper and Dniester rivers or the last vestiges of Iranian language bearers-Alans Ossetians-93 to compared to Haryana R1a-93.

    ReplyDelete
  121. @open genomes

    ASI is not represented at all by andaman islandees or onge, ASI is extremely distant from onge/andaman islanders, the genetic is almost as big as between east and west eurasians, so to call them related is highly misleading, its safe to say the pure asi did not look even remotely similar to andaman islanders.

    ReplyDelete
  122. @ a

    I highly respect your post. There are two sides your right on that. It good to see some intelligence on here. I’m not saying that most comments are unintelligent but perhaps biased? Anyway your post was very good. I like your thinking.

    ReplyDelete
  123. @Davidsiki
    What you don’t like is simply what I postulate. My arguments that you delete are basically jsut:

    Where steppe admix and R1a was prevalent curiously enough corresponds to precisely the portion of Eurasian/Europe where we have a 5000 years absence of any relevant human edification, civilization or any other beacon of innovation. If either of those two genetic vector had anything to it, then those regions would have left markings, any at all, in history by themselves – In fact, it’s the opposite, as you can see by any YouTube history of last 5000 years..

    So, how is that a juvenile argument?

    ReplyDelete
  124. @Open Genoms

    That is certainly not accurate. We will soon know with ancient DNA.

    Lazaridis et al. (2015) "Unlike Europe where a substantial number of pre-agricultural hunter-gatherers is available for study, the earliest population substratum of the “Ancestral South Indians” (ASI) is only indirectly known by its distant relationship to the Onge hunter-gatherers from the Andaman Islands, a population that may be an imperfect proxy for the ASI."

    We can also see in Eurogenes Basal Rich K7 for example, ASI admixture in South Asians breaks down into East Eurasian-Ami, Southeast Asian-Onge, Oceanian-Papuan. For example, in ASI-rich Panya tribe (from Kerala) their "ASI" admixture breaks down as 29% East Eurasia, 15% Southeast Asia, 10% Oceania. Oddly, EE-like admixture seems to be dominant in ASI break down in South Asians.

    https://docs.google.com/spreadsheets/d/1tFAa7oxWpcNN-OdMMjBdb4NeWKG7EkpKMzZJVW2_MME/edit#gid=1829029512

    Ultimately aDNA will solve this but from what i see in admixtures, ASI will turn out to be something "Proto" East Eurasian/ENA or something intermediate between EE-ENA. Since its break down is very pan-Asian, it's something ancestral or intermediate.

    ReplyDelete
  125. @Grey - "one possible explanation is the Iranian plateau is too dry for cattle - sheep and goats only (according to the interwebs yesterday)."

    I think it's more just a matter of IE migrants in to Iranian plateau facing greater competition from Elamite, Hurrian, Semitic (and potentially other) pastoralists. IVC was more sedentary (much like much of Mesopotamia), and Indo-Europeans arrived right when sedentary living became strongly disfavoured by the climate.

    ReplyDelete
  126. Now that Alexandria appears to be 200 km to the east the discussion Alberto and I had has gotten a new dimension. Alberto rightly noticed that the previous mesolithic population of the Ukraine contained to much WHG to be the source of the HG part of Yamnaya. Alberto drew the following conclusion from this:

    "The possible origin of such population can be:

    - The North Caucasus
    - The North Caspian region
    - Central Asia?
    "

    I mentioned that technically it could still be from the north, albeit in a very limited time frame. However, Alexandria being 200 km east makes that possibility larger.

    But what struck me is that Alexandria also has a tad ENF just like German CW. Could it be that German CW was straight from Alexandria? When these samples come out, how could we check that?

    ReplyDelete
  127. @a

    As for the Beast in R1a - that two has 2 sides, and depends on who controls the narrative/blog. R1a-Z93 was not so successful in it's original birthplace and Arkaim-Sintashta and surrounding regions.

    Despite having fortified complex's with moats, choice weaponry, war chariots and large funeral feasts with many allies have little R1a-Z93 in the current maps.


    Not sure what point you're trying to make here, but obviously the awesomeness of Sintashta and related peoples, like the Scythians, helped to make R1a the beast that it is.

    In any case, thanks for pointing this out so that Olympus Mons sees it, because obviously the Youtube clips he's been watching didn't discuss any of it.

    @Olympus Mons

    In fact, it’s the opposite, as you can see by any YouTube history of last 5000 years..

    So, how is that a juvenile argument?


    LOL

    @epoch2013

    But what struck me is that Alexandria also has a tad ENF just like German CW. Could it be that German CW was straight from Alexandria? When these samples come out, how could we check that?

    It might be possible with formal stats and qpAdm.

    ReplyDelete
  128. @ Davidski.
    And rest my case....lol.
    You attacking de form and run way from any of the arguments like a scared kid

    Textbook, dude, textbook. Thank you.

    ReplyDelete
  129. @Bronze

    ASI is not represented at all by andaman islandees or onge, ASI is extremely distant from onge/andaman islanders, the genetic is almost as big as between east and west eurasians, so to call them related is highly misleading, its safe to say the pure asi did not look even remotely similar to andaman islanders.

    ASI is just another Eastern non-African (ENA) component, one specific to South Asia. It's not fundamentally different from East Asians or Onge.

    It's likely that this where ASI genomes will cluster on a global plot (look for Mesolithic South Asians).

    The peopling of South Asia: an illustrated guide

    ReplyDelete
  130. @David - "Not sure what point you're trying to make here, but obviously the awesomeness of Sintashta and related peoples, like the Scythians, helped to make R1a the beast that it is."

    Of course awesome from one standpoint is monstrous from another. A horde of horse riders raping and pillaging your countryside isn't exactly a good time.

    ReplyDelete
  131. @Ryan

    By all accounts, Sintashta and close relatives were quite a civilized bunch. They did help to revolutionize warfare with their chariots and whatnot, but developments in warfare were always one of the main driving forces of human civillization.

    Scythians were probably monstrous to a lot of people, but pillaging is not all they got up to. Lots online about their awesomeness.

    ReplyDelete
  132. @David - "Not sure what point you're trying to make here, but obviously the awesomeness of Sintashta and related peoples, like the Scythians, helped to make R1a the beast that it is."

    Scythian points you want to highlight?

    How do you know those single rider chariots were not used for decorative showmanship? Or maybe they helped transport neurologically impaired cripples from years of toxic fumes, while smelting in their homes[Weekend at Bernies?]. Joking aside-
    As for actual chariot- warfare battle of Kadesh-3 man chariot,perhaps one of the largest.
    Steppe warfare and Scythians-
    Horse and lance evolved in the same region. To drive a lance into a spoked wheel could seriously damage the chariot/rider.
    Ateas[90 year old?] suffered defeat at the hands of the Macedonians.
    However it was the Sarmatians[skilled in armor/15 foot lance] that over ran their lands and dominated them for 5centuries+/-. Perhaps that explains why there is very little in the way of R1a-93 around their original homeland.

    ReplyDelete
  133. Great new article on the pre-IndoEuropean substrate language in Scandinavia. The Neolithic language may have had an a-prefix and generated many agricultural terms such as those for chickpeas and peas and sturgeon. Explains well the interactions between Neolithic TRB and Yamana-derived IE populations.

    http://www.jstor.org/stable/10.3764/aja.121.4.0511

    ReplyDelete
  134. @Davidski
    The Sintasha and Scythians seem awesome (literally evoking fear) from an Ares point of view. They were not awesome from an Aphrodite or Philia POV. A little Nietzschean I presume?

    ReplyDelete
  135. R1b L151 might be restricted to Western Europe but its brother R1b Z2103 is big in Mesoptamia, Turkey, Caucasus, and Volga. R1b L151 isn't isolated, it's apart of the bigger R1b L23 phenomenon. Afanasievo and North Bell Beaker derive from the same early IE group.

    ReplyDelete
  136. Thanks David for that paper of Early Scythian period .

    Thanks Roy for that paper .


    About the Z-93 issue and of course M417 , we should wait for results from proper IVC , which was the most populated civilization and BMAC, I am personally very interested on Gonur Depe .

    ReplyDelete
  137. Samuel,


    R1b L23 phenomenon. Afanasievo and North Bell Beaker derive from the same early IE group.

    First of all we can't put face value ''y-dna = language group'' .Secondly , Afanasevo probably went extinct , it is also interesting that in Xiaohe the y-dna is R1a not R1b , I have pointed this many times , Xiaohe and Tarim are a good candidate of being Tocharian ...

    ReplyDelete
  138. @ Nirjhar007

    Where did the Uyghurs get their R1b from ?

    ReplyDelete
  139. There aren't any recent studies, but most Uighur R1b could be an M73 Turkic line, but also some older M269 and P343

    ReplyDelete
  140. @ Rob
    “There aren't any recent studies, but most Uighur R1b could be an M73 Turkic line, but also some older M269 and P343”

    I have explained in many letters the origin of the R1b in central Asia from the few subclades, above all at the R-L23 level, present in Yamnaya and migrated Eastward, but not the origin of the R1b haplogroup there. Read all what I wrote about R-V88, R-L389, but also R-L73, present in Asia only in the R-M73-M478 subclade, etc etc.

    ReplyDelete
  141. @nirjhar

    @nirjhar

    "About the Z-93 issue and of course M417 , we should wait for results from proper IVC"

    Unless you think that the IVC samples are going to look like bronze age steppe people, I can't imagine what you think will be found which would suggest that M417 is native to the IVC area? M417 is in Ukraine circa 4000 BCE, in a guy who looks very corded ware. He had no s/c Asian ancestry, and M417 was fairly young at the time. Modern Indians have steppe ancestry and speak an indo-European language, to a great extent, on top of their having tons of M417. There are things we don't know, as always, but in the big picture the pieces fit, that's obvious. Do you have a plausible alternative theory?

    "Afanasevo probably went extinct , it is also interesting that in Xiaohe the y-dna is R1a not R1b"

    But Uyghurs have R1b, and are clearly Asian/Euro hybrids, to put it crudely. Why do you suppose that is? And we know that R1a and R1b coexisted on the steppe, not long before Afanasevo formed, they were living together in Khvalynsk. Do you think it's reasonable to assume that Afanasevo was 100% R1b? Again, the big picture. I think you're focusing on relatively small details, instead of looking at the totality of the evidence.

    ReplyDelete
  142. @Bob,
    "But Uyghurs have R1b, and are clearly Asian/Euro hybrids, to put it crudely."

    Their non-Asian side might be more Southcentral Asian than "European" (Steppe). That Southcentral Asian has a big chunk of Steppe of course but has more Iran Neolithic-like and ASi-like stuff.

    ReplyDelete
  143. @Sam

    "Their non-Asian side might be more Southcentral Asian than "European" (Steppe). That Southcentral Asian has a big chunk of Steppe of course but has more Iran Neolithic-like and ASi-like stuff."

    You're right and I understand that Turkic ancestry can look like steppe ancestry sometimes, but I think the greater point stands. At least a chunk of that R1b could easily be from Afanasevo.

    ReplyDelete
  144. @ Rob
    @ Samuel Andrews

    It is worst to you if you don’t know what has been written on an argument. A researcher is just who knows all what has been written before him. You aren’t researchers, you are ridiculous, and it is a waste of time to dialogue with you. Of course many sites where I wrote are out now, but what is written will always remain on the web (Rootsweb, DNAforums, Worldfamilies, Dienekes’ Anthropoly blog, eng.molgen, Anthrogenica, many FB pages, Maju’s blogs, etc) and I am grateful to Davidski for permiiting me to wirite here. But I have with you, Rob, many letters exchanged on FB Messanger, and what Samuel says now (that R1b may have come from South Asia, where it hasn’t been found so far and it won’t be), demonstrates all his level of knowledge.

    ReplyDelete
  145. bob,

    Big picture? we are not at big picture here , wait for more samples . I am not saying M417 is native of S Asia , just that it should be present there before 2000 BC , but anything is possible with aDNA , as I said IVC was the most populated civilization with a vast area and there is in fact ,no sign of anything coming from Steppes . I am not yet convinced about a steppe ancestry among Indians , it can be more ancient and local than perceived.

    About Uyghurs , I don't know about their R1b , they also speak Turkic .

    ReplyDelete
  146. @ Roy King

    I wrote on FB YFull page that your mistake about my name from you was “innocent”, nothing to do with the provoker you know. I’d be glad to read the paper you quoted above, which unfortunately isn’t for free, because I’d be glad to verify at the linguistic level what it says, not being convinced that the satem IE from Yamnaya may have brought there German, which is a centum language. I read everything before saying something about an argument.
    P.S. I had a problem with my PC and, as after Office was installed (very likely there is a program that has something to do with Italian language), where I wrote “provoker” it writes “provole”, as it wrote “incesto” when I wrote ancestor, because the closest words to some Italian word. Unfortunately I am a newbie in informatics.

    ReplyDelete
  147. @Gioiello,
    "what Samuel says now (that R1b may have come from South Asia"

    I never said that.

    ReplyDelete
  148. http://www.sciencedirect.com/science/article/pii/S1875176817300501

    http://www.sciencedirect.com/science/article/pii/S1875176817300574

    ReplyDelete
  149. @ Samuel Andrews
    “@Gioiello,
    "what Samuel says now (that R1b may have come from South Asia"

    I never said that.”

    I apologize if I misunderstood what you wrote:

    “@Bob,
    "But Uyghurs have R1b, and are clearly Asian/Euro hybrids, to put it crudely."

    Their non-Asian side might be more Southcentral Asian than "European" (Steppe). That Southcentral Asian has a big chunk of Steppe of course but has more Iran Neolithic-like and ASi-like stuff”.

    Id est not Asian side of the Uyghurs (Asian in the meaning of Turkish) “might be more Southcentral Asian than “European””, but that, even though linked with Yamnaya “has more Neolithic-like and ASI-like stuff”…

    You may say that English isn’t my language, but are you sure that it is yours?

    ReplyDelete
  150. This is not a big picture but a censored one.
    First of all Sampling in yamnaya and Eastern Europe is ~50 x higher than Central Asia and Siberia and then David has done his own filtering E.g Oldest r1a is from two vastly separated sites one in baikal and the other khvalynsk

    ReplyDelete
  151. zoroastrian elite don't have any r1a and and are Iran-neo shifted. If the steppe scenario is right then they should be more steppe vs other Iranians

    ReplyDelete
  152. @postneo

    There are R1a samples from around Lake Baikal and Khvalynsk older than the Ukrainian one? Where are you getting this information?

    ReplyDelete
  153. The oldest Siberian R1a is at least a couple thousand years younger than the Ukrainian R1a.

    Noncalibrated radiocarbon dates (Isotrace, University of Toronto) from Lokomotiv suggest that this cemetery was used from approximately 7250–6040 BP. These dates correspond to the period between 6125–4885 BC when calibrated with the methodology of Stuiver et al. (1998)

    http://onlinelibrary.wiley.com/doi/10.1002/ajpa.20247/abstract

    Make an effort to get your facts straight next time you post here.

    ReplyDelete
  154. Thank you 3B for those articles! .


    Yes it will be awesome, to have more detailed data of those Lokomotiv dudes..

    ReplyDelete
  155. @ Davidski

    So was this an earlier Pre-Khvalynsk migration to lake Baikal ? Maybe more related to the Dnieper Donets Culture ? Were they part of the Proto-Indo-European formation or totally different ? Did the later Afanasevo Culture Indo-Europeanize those people ?

    ReplyDelete

  156. Ukraine
    Vasilyevka 3 [I1819 /
    skeleton 37]
    M
    8825-8561 calBCE
    813114
    R1a
    R1a: L62: 17891241A->G; R1a: L63: 18162834T->C; R1a: L145: 14138745C->A; R1a: L146: 23473201T->A; R1: CTS997: 7132713G->A; R1: CTS2565: 14366723C->T; R1: CTS3123:14674176A->C; etc.
    U5b2

    Jones 2017; Mathieson 2017

    ReplyDelete
  157. 6125–4885 BC against 8825-8561 calBCE

    long more than 2000 years, because the CI is much less

    ReplyDelete
  158. @Ric

    I don't know who they were or what their overall genetic structure was like, but it seems they may have been from the west and were replaced by groups resembling modern-day Siberians before Afanasievo and Andronovo got to South Siberia.

    ReplyDelete
  159. Davidski

    Do we have any reasonable density DNA samples from the Central Asia/South Siberia region from the time period between Mal'ta and the Baikal samples? If not, then the Ukrainian sample's seniority is not very decisive or even that much relevant for the question of the origin of R1a itself. The age of the Ukrainian sample is not particularly close the estimated age of R1a after all.

    ReplyDelete
  160. @Slumbery

    As per my blog post, R1a in all likelihood originated somewhere in North Eurasia. I guess one day we'll figure out where exactly, not that it's a big deal or anything or relevant to the PIE debate, but to date, by far the oldest R1a is from the Pontic steppe in Ukraine, so the Pontic steppe is a strong candidate for the R1a homeland.

    ReplyDelete
  161. The dating of R1a-M417 is NOT calBP! There are just 6200 BP obtained by the average range of all the steppe Eneolithic! It is not the dates for this sample. But there are dates for the other samples, Mathison wrote, "Alexandria is dated to ~3600-3400 BCE".

    ReplyDelete
  162. @supernord

    Objection noted, but for now I'm just going to quote the spreadsheet from Mathieson et al., because I can't be bothered editing the image again.

    Average of 95.4% date range in calBP (defined as 1950 CE)

    6200

    ReplyDelete
  163. See column name "Date: One of two formats. (Format 1) 95.4% CI calibrated radiocarbon age (Conventional Radiocarbon Age, Lab number) e.g. 5983-5747 calBCE (6980±50 BP, Beta-226472). (Format 2) Archaeological context date, e.g. 2500-1700 BCE "
    Name of other column is reduction of a description, only to the first format of this explanation.
    The date is Format 2 (the fact!), but not calibrated radiocarbon date (the fact!) and cannot be calBP.

    ReplyDelete
  164. Alright supernord, I made the correction...

    https://1.bp.blogspot.com/-SF74a3xkvg4/WdDa0l5addI/AAAAAAAAGH0/BM8SEreRWfMF_tpH2pfEpd20-68zOE90gCLcBGAs/s380/R1a-M417_The_Beast.png

    ReplyDelete
  165. Davidski
    I have the impression that in ancient DNA R1a is pretty much always comes together with the presence of ANE in genome-wide terms. There is no R1a without ANE, except maybe very late samples where it could be diluted to noise level. If that is true, then R1a is very likely to be an ANE lineage. Doesn't that weaken the chance of a very western (for example Pontic Steppe) origin?

    Note: I agree that this is not important to the PIE debate. The known date of R1a presence on the Pontic-Caspian region is plenty old enough to support your argument.

    ReplyDelete
  166. All of the forager samples from the Pontic steppe have plenty of ANE, so that's not an issue.

    ReplyDelete
  167. Davidski

    Of course they have, that is part of what I am saying. But those samples are much later than the presumed starting date for R1a. Isn't the oldest ANE related sample, that actually even used to represent ANE in models, is from the Baikal region? When did it reach Europe? When was EHG formed as a separate group?

    ReplyDelete
  168. How do you know that older samples from the Pontic steppe won't show both ANE and R1a? Maybe the first person with the R1a mutation lived on the Pontic steppe and was a mixture of an Kostenki14-related population and recent R1 migrants from Siberia?

    But in any case, I'm not really interested in this type of speculation, and I honestly don't care much where the first person with the R1a mutation lived.

    ReplyDelete
  169. Khvalnsk is older than bakal.
    xiao-he is also similarly younger than cw

    but sampling is negligible and from what we gather these areas in general had similar haplogroups through the ages, despite the huge distances involved.

    ReplyDelete
  170. @slubberry
    "Doesn't that weaken the chance of a very western (for example Pontic Steppe) origin? "

    It does not weaken or strengthen the case. Its possible that r1a originated in khvalynsk but asserting so with the current lopsided sampling is foolish.

    ReplyDelete
  171. @ PostNeo

    Where are you getting your figures man ?
    Khvalynsk most likely dates from after 4200 BC
    The Baikal neolithic samples, which featured 2 x R1a-M17 date to ~ 5500-5000 BC

    ReplyDelete
  172. So did pottery that spread from Lake Baikal maybe trigger the curiosity of some Dnieper Donets people who then migrated to find the source ?

    If there was a migration, what would have triggered it ? Maybe the R1b peoples of the Balkans were pressed Northwards and into Ukraine and this pushed some R1a peoples North and Eastwards ? A chain reaction...

    ReplyDelete
  173. @Rob.
    To me is always a mess with Khvalynsk. If it is 5200bc is one thing, if its 4200bc its a different thing. And I suppose you know what I mean. :)

    Do we know which is it? did something change? saying 5400bc-4200bc is meaningless...

    ReplyDelete
  174. @ OM
    Yep some older works placed Khvalynsk to 5200 BC. But after considering reservoir effects, it's been lowered to 4300-3800 BC
    (https://journals.uair.arizona.edu/index.php/radiocarbon/article/viewFile/3511/3026)

    The steppe eneolithic could be older in Ukraine (4500 Bc).

    ReplyDelete
    Replies
    1. ^ of course, we should ask for a similar re-evaluation for Altai side too.
      Whatever, it seems only reverent for older R1a Clades, not Z645.

      Delete
  175. Oldest R1a1 is 8280 calBP in Yuzhnyy Oleni Ostrov, Lake Onega, Russia.


    According to Danilenko (1974), Kotova (2006) Sredny Stog culture spread from the east to the Don river and for him. Dreive culture from the North-East. Dniep-Donets culture has part of North-East invaders. Ukrainian HG is not ancestral to Yamnaya culture people, according to Mathieson, and apparently, Sredny Stog. According to Mathieson ancestral to them is still the same North-Eastern EHG.

    ReplyDelete
  176. @ supernord

    Didn't Sredny Stog spread from the West into Khvalynsk, admixed and then formed Repin and Yamnaya ? That is how I understand the latest Archaeological Paper about Sredny Stog.....

    ReplyDelete
  177. The Sredny Stog and Khvalynsk are related and began at the same time culture. The origin of one from another is unknown. But it is known that origin of the Sredny Stog culture is the Don river closed to the Volga river.
    The origin of Repino and Yamnaya cultures from other cultures is unknown.

    ("Dreive" there's a misprint, read Dereivka.)

    ReplyDelete
  178. @ Supernord

    Sredny stog went from west to east
    But there was a middle Eneolithic "reflux" from east to west, or perhaps from the southeast (Kuban foothills).

    ReplyDelete
  179. @Rob, you are fully wrong.

    ReplyDelete
  180. The early Suvorovo-Skelya phase "Relations with the Cucuteni-Tripolye culture are attested by zoomorphoc sceptres of the Suvorovo phase, which appear in sceptre-bearer graves as well as in
    Cucuteni A3—4 / Tripolye B1 settlements. From
    there they spread farther to the east to the Volga River and the North Caucasus "

    This began c4500 BC in the western steppe ("This is based
    on analogies with the necropolis Varna II, the
    Carbuna hoard, a Gumelnita A2 vessel found in
    Giurgiuleşti, and Cucuteni pottery in Căinari 2 and radiocarbon datings (Girugiuleşti 4490—4330;
    Căinari 4455—4360 BC)"
    Khvalynsk dates from 4300 at earliest.

    ReplyDelete
  181. @Rob, you dont't understand this text. The text is description of "zoomorphoc sceptres", but about not Sredny Stog culture (or Khvalynsk culture)! Tripolye B1 is final phase Sredny Stog culture (Sredny Stog II), after it began Dereivka culture.
    Khvalynsk dates much erleast that 4300 BC, at 4300 BC Khvalynsk culture is down.


    Rob, I wrote to your facts form (all) Ukrainian archeologists. You don't understand the texts that you reads. You can stay in delusion or normally study archeology, not scraps.

    ReplyDelete
  182. @ Supernords
    Ok. please enlighten me with the facts so I dont stays in delusions. What do you even mean by Sredy Stog, because it's an outdated term due to the elaboration of newer, more chronologically and culturally circumscribed definitions

    ReplyDelete
  183. Also, although in struggling to understand what you're attempting to communicate, you seem to be ignoring the new dates listed above for Khvalynsk
    Given that the Skelya- Suv. Phase is the earliest stage of Sredni Stog II, your objections are unfounded

    ReplyDelete
  184. Rob, no need to write fantazy if you do not know the subject about which you write. I I see it. See the descriptions of the archeologists https://www.academia.edu/19575239/Early_Eneolithic_in_the_Pontic_Steppe 64, 78
    Everything I wrote has been known in 1970th years.]

    ReplyDelete
  185. @ Supernord



    I have just outlined two start of the art publications, which you have chosen to ignore. And here's a third (Rassamakin 1994, and ) The Skelyansk culture is the older Ensolithic culture...determined to be 4500-4100 BC"
    With the late & Final Eneolithic falling to 35/3400 - 29/2750 BC), coinceident with the start of Yamnaya. (Rassamakin 2006)
    Back to the Khvalynsk paper by Shishlina (2009) "the time interval for the Caspian steppe Eneolithic population has now changed
    to 4300–3800 cal BC."

    Are you able to provide any convincing reasons why we should ignore the data of these specialists in favour of your poorly articulated & outdated opinions ?

    ReplyDelete
  186. Rob, you are reading outdated opinion Rassamakin, about dedicated only to them the Skelyansk culture that no one but him was not accepted. I gave you a link to Kotova 2008 radiocarbondating dates and extensive synchronization of cultures (https://www.academia.edu/19575239/Early_Eneolithic_in_the_Pontic_Steppe 64, 78). The Skelyansk culture simply does not exist, the attempt to allocate from the Sredny Stog to a new culture was not successful, in any case, we are talking about an Sredny Stog & Khvalynsk that is older than Skelyansk type.
    Read this!

    ReplyDelete
  187. Sure one can claim certain perspectives of categorisation are better than others, but your attempting to dismiss the fact that
    Khvalynsk has been determined to date to 4300-3800 by the people who actually analyse it . And if that synchronises with SS, what does it say ?
    And the earliest reference was Govedarica, so no lone voices

    ReplyDelete
  188. Rob, you are absolutely wrong. You spread incorrect dating of the Khvalynsk culture, because they know nothing about it. Perhaps because you don't understand the difference between calibrated and not calibrated dates? I brought facts direct from them who does radiocarbon dating, you wrote your imaginations.
    This discussion is useless because you ignore the facts.

    ReplyDelete
  189. @postneo

    The oldest R1a to date is not from Khvalynsk. It's from a Mesolithic hunter-gatherer site in Ukraine dating to 10643 calBP. The Khvalynsk R1a only dates to about 6000 BP.

    Please confirm that you understand this.

    ReplyDelete
  190. @supernord

    You're wrong this time about the oldest R1a.

    ID: I1819 R1a Ukraine_Mesolithic Vasil'evka 8825-8561 calBCE

    ID: I0061 R1a Karelia_HG Yuzhnyy Oleni Ostrov 6270-6000 calBCE

    The Ukrainian R1a is more than 2,000 years older, no?

    ReplyDelete
  191. @ supernord

    Yes I am familiar with the difference , thanks for asking
    In Western academic literature, it's expected / encouraged to refer to calibrated BCE dates
    In fact, it was written in the very quotes you keep ignoring
    But here it is again.

    "After applying a reservoir effect correction for the steppe Eneolithic period, the time interval for the Caspian steppe Eneolithic population has now changed to 4300–3800 cal BC."

    This agrees with neighbouring regions too, eg Hungary ("The recently obtained radiocarbon data of the Csongrád-Kettőshalom grave is 4370–4240 calBC, in good correlation with other Steppe Ochre Grave data (goveDarica 2004), but a little bit earlier then the Middle Copper Age.
    In Eastern Europe this is the period of the Early Eneolithic (4550–4100/4000 BC) of the Eurasian steppe region. The period of the Khvalynsk and Skelya cultures is contemporaneous with the Cucuteni A-Tripolye B1 phase..."

    Now, maybe your sources can speak to you about reservoir effects & propper pretreatment of materials

    ReplyDelete

Read the rules before posting.

Comments by people with the nick "Unknown" are no longer allowed.

See also...


New rules for comments

Banned commentators list