search this blog

Tuesday, May 2, 2017

Kostenki14: morphologically Caucasoid


Remember that Melanesian-like old bust of the Man from Markina Gora aka. Kostenki14? Well, apparently he didn't look like that. Behind a paywall at Herald of the Russian Academy of Sciences:

Abstract: The latest results of anthropological studies of bone remains from the earliest Upper Paleolithic burial discovered on Russian territory, the Markina Gora site (Kostenki 14), are described. Multivariate statistical methods and parallel studies of the buried skull structure and dentition established that their morphological characteristics undoubtedly belonged to the Caucasian complex. In combination with paleogenetic data, the findings contradict the earlier hypothesis of the southern origin of the Kostenki 14 individual and its similarity to the population of the Australo-Melanesian region.

Moiseev, V.G., Khartanovich, V.I. & Zubova, A.V., The Upper Paleolithic man from Markina Gora: Morphology vs. genetics? Her. Russ. Acad. Sci. (2017) 87: 165. doi:10.1134/S1019331617010099

See also...

Kostenki14: first genome of an Upper Paleolithic European

The genetic history of Ice Age Europe (Qiaomei Fu et al. 2016)

On the modern genetic affinities of Ice Age Europeans

114 comments:

Ariel said...

With all that we now know about population genetics and ancient dna, does terminology like "caucasian complex" make sense anymore? Can we apply it to ANE rich or Basal rich populations? Is it just a case of convergent evolution? (like prognathism in southern hemisphere populations)

Unknown said...

Most of those are found in India as well in addition mammoths are tropical? Since when? Mammoths are like the opposite of tropical. K2a y-dna and C1a/b y-dna was found in Ancient Europe which completely destroys your fantasy these lines are never found in Africa.

Please don't ramble anymore until you have ancient dna evidence (which you wont).

Thank you.

MaxT said...

I don't think such classifications makes sense for Upper Paleolithic or even Mesolithic populations.

As per the study :

"Both central and lateral incisors have a shovel
shape of the lingual surface. It is not developed to such
a degree that we can speak about an individual affinity
to Mongoloid populations, but it is expressed more
strongly than in the tropical complexes and is not
accompanied by the enlargement of the lingual cusp."

I'm not sure what types their 'Caucasian complex' includes. But, from that description sounds like he could be some kind of 'Proto-Caucasoid' or 'Archic Caucasoid'? which is often used for Native Australians as well but he would look nothing for like what we consider Caucasian today.

Unknown said...

What is the scientific relevance of this? Sounds like a bunch of insecure European researchers terrified at the idea of pre-historic Europeans looking "Black."

P Piranha said...

Shovel shaped incisors are in fact a Mongoloid trait. Far better to say that this person was a caucasoid or incipient caucasoid with retention of generalised archaic Eurasian characters, such as the incisors, the limb proportions, the low nasal root and the prognathism.

Early Amerinds and East Asians all looked like Polynesians morphometrically and Ainu still do, which is really due to Polynesians being quite generalised among Eurasians.

MaxT said...

@JacksonNeptune

He looks like Upper Paleolithic Eurasian. Genetically he is closest to modern Baltic and Scandinavians. There is nothing 'Black or African' about him genetically either.

Unknown said...

@MaxT My point is that all this is scientifically irrelevant. Why are Europeans so obsessed with disproving the "non-Caucasoid" features of this specimen?

Unknown said...

What some people don't understand is how Australoaids are not modern 'African' at all in any way shape or form. In fact they are more 'Europid' than African if you look at the basal haplogroups. I believe I saw a study and they are actually the least African people in the world. Although the evidence is weak a small amount of evidence exists that prehistoric Europeans may be Ancestral to most of Humans, perhaps 40-45kya C,F y-dna originated in Prehistoric Europe (ancient dna supports this), while D was in East Asia/India and E was found in between maybe in the Near East where it seems E1b1b originated from the Levant but 40-45 kya may have been further west I.E Iraq, Iran or Persian Gulf area. This is the only logical explanation I have for the distribution of D compared to E its almost like they bordered each other but European CF cut them apart so now they are found on opposite sides of the world.

Blogger said...

Interesting interesting. Continue on gentlemen.

MaxT said...
This comment has been removed by the author.
When_in_Rome said...

@JacksonNeptune

Europeans are not obsessed with "disproving" the 'non-Caucasoid' features of Paleo-European samples. Europeans are not insecure or terrified about the appearance of Paleo-Europeans. People are just concerned with where the evidence leads them. The people that did this study are scientists who are concerned with popultaion movements and genetics. They are not concerned with some conspiracy to hide evidence about the Out of Africa origins, etc. The reason this study was done seems to be for better understanding early Europeans. Craniometrics are still used today in crime scene investigation since there are some general truths to it. The study "The questionable contribution of the Neolithic and the Bronze Age to European craniofacial form" by Brace, et. al. (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1325007/) used craniometrics to better undertand the neolithic expansion into Europe. These craniometrics let them know how populations can be related. That's why its relevant. By claiming that Kostenski14 looks morphologically Caucasoid, they mean that he statistically matches populations we would call Caucasoid closer than he does other populations.

Best

Anthro Survey said...

I would refrain from labeling him as Caucasoid because I don't believe the true Caucasoid morphology was a reality until two ancestral clades mixed: western Upper Paleolithic Eurasians and Basal Eurasians. Hence, I believe the first true morphological Caucasoids were probably to be found among Natufians or CHGs.

Now, Kostenki and Loshbur for that matter do have many common motifs with modern Caucasoids. No question about this.

But, then again, most modern populations where the Caucasoid morphology is in the majority are >50% western upper paleolithic. Even peninsular Arabs.

Kostenki's shared traits with modern Mongoloids or Australoids can be explained by thr fact that ENA/ASE and ANE/WesternHGs were sister branches.

batman said...
This comment has been removed by the author.
MaxT said...

@Anthro Survey/JohnSmith

Beyond stupid! *facepalm*

That's NOT what geneticists say on how humans spread out, you guys are fringe-theorists. Humans fanned out to Middle East, Asia, Europe, Oceania at the same time from Africa.

@JohnSmith

OOA did happen, get over it.

Anthro Survey said...

Max, at what point do I deny this? lol strawman...

And I don't deny OAA either, btw, to forestall any criticism.

Anthro Survey said...

OOA*

MaxT said...

@AnthroSurvey

I was addressing John Smith about OOA denial, looks like he deleted his comment.

Spanked said...

@JacksonNeptune"Why are Europeans so obsessed with disproving the "non-Caucasoid" features of this specimen?"

Because they're all horrible racists, right? That's what you're inferring, isn't it.

Samuel Andrews said...

@Anthro Survey,
"I would refrain from labeling him as Caucasoid because I don't believe the true Caucasoid morphology was a reality until two ancestral clades mixed: western Upper Paleolithic Eurasians and Basal Eurasians"
@Maxt
"I don't think such classifications makes sense for Upper Paleolithic or even Mesolithic populations."

The origins of the modern "Caucasoid" phenotype can't be explained by known genetic components; ANE, WHG, CHG, etc. Here's are the reasons why.

First, all of those components are interrelated. Many "Caucasoid" traits might derive from their distant Paleolithic common ancestors who lived when Kostinki did.

Second, many "Caucasoid" traits might just be human traits which other populations lost. Theoretically all populations may have preserved some traits and lost others. In my opinion African Americans have moe similar facial features to white Americans than they do to East Asians even though Europeans are a lot more related to East Asians.

Samuel Andrews said...

@Salden,

Don't degradeingly call them Negroes. You weren't born in 1885, you know that today we say Black or African American and that Negro is used to insult them.

And while British admixture makes an impact, my point stands that Africans and Europeans share facial features which East Asians don't have.

Davidski said...

I'm sort of confused by the Afrocentrism-related discussion in this thread...?

xyyman is banned, so there's no point replying to him when he does manage to post, right? And Kostenki14 has nothing to do with Africa.

The anthropological paper in question just backs up what we've learned from ancient genomics, which is that Kostenki14 is the first ancient genome to share more drift with Europeans than any other Eurasians, and this suggests that the European genotype began forming around 37K years ago.

I've linked to the blog entries on the relevant ancient DNA papers. So there's really nothing to discuss here apart from the topic of correlations between genomic and morphological analyses of ancient remains, so why don't you all do that?

Mark Moore (Moderator) said...

@ Max T....Where are you getting that K14 was 14%-17% Basal Eurasian? I thought Lazardias had said that this was another component which only looked like the BE he had found in some respects. K14 shows heavier Neanderthal admixture is typical today even in pops with no BE to speak of (like East Asians) yet one of the hallmarks of the BE Lazardias found was that more BE meant less Neanderthal.

Karl_K said...

@MaxT

"he carried somewhere between 14%-17% 'Basal Eurasian' ancestry"

This has been shown to be a mistake. He did not carry Basal Eurasian ancestry after all. Read the paper 'The genetic history of Ice Age Europe'.
"A previous genetic analysis of early modern humans in Europe using data from the ~37,000-year-old Kostenki14 suggested that the population to which Kostenki14 belonged harboured within it the three major lineages that exist in mixed form in Europe today4, 15: (1) a lineage related to all later pre-Neolithic Europeans, (2) a ‘Basal Eurasian’ lineage that split from the ancestors of Europeans and east Asians before they separated from each other; and (3) a lineage related to the ~24,000-year-old Mal’ta1 from Siberia. With our more extensive sampling of Ice Age Europe, we find no support for this. When we test whether the ~45,000-year-old Ust’-Ishim—an early Eurasian without any evidence of Basal Eurasian ancestry—shares more alleles with one test individual or another by computing statistics of the form D(Test1, Test2; Ust’-Ishim, Mbuti), we find that the statistic is consistent with zero when the Test populations are any pre-Neolithic Europeans or present-day east Asians3, 13. This would not be expected if some of the pre-Neolithic Europeans, including Kostenki14, had Basal Eurasian ancestry."

Karl_K said...

"Han Chinese share more alleles with two Villabruna Cluster individuals (Loschbour and LaBrana1) than they do with Kostenki14, as reflected in significantly negative statistics of the form D(Kostenki14, Loschbour/LaBrana1; Han, Mbuti)4. This statistic was originally interpreted as evidence of Basal Eurasian ancestry in Kostenki14. However, because this statistic is consistent with zero when Han is replaced with Ust’-Ishim, these findings cannot be driven by Basal Eurasian ancestry (as we discuss earlier), and must instead be driven by gene flow between populations related to east Asians and the ancestors of some Europeans."

Karl_K said...

@MaxT

He also was not necessarily from a totally 'dead end' lineage.

See:

Extended Data Table 6: All European hunter-gatherers beginning with Kostenki14 share genetic drift with present-day Europeans

Unknown said...

@MazT OOA probably did happen but no ancient dna proves it did. C1a and K2a were found in upper paleolithic Europe. People moved a lot. Modern dna is useless for saying were people originated more than 35kya. Fact. We don't know where humans originated without ancient dna from the places we think they originated. OOA is just a hypothesis and will remain so until ancient dna either proves it or disproves it. Get over it. If I told you K2a, C1a, C1b was found in Upper Paleolithic Europe as well as M and U6 mtdna five years ago you would have told me I was crazy. And don't bring up Mota he is 4kya old he is about as useful as a modern sample.

MaxT said...

@Karl_K

Thank you, Karl! Which study is this, is this from Fu et al. 2016? I was under impression for sometime now that he had Basal Eurasian admixture based on previous studies.

MaxT said...

@John Smith

Finding C1a and K2a does not mean ENA groups (East Eurasians, Australasians, Pacific Islanders) came from Upper Paleolithic Europe as you were trying to suggest earlier. Yes, people moved around, C1a, M, K2a moved into Europe as first wave of humans who entered Europe, over time were conquered/replaced by new waves of humans who entered Europe, with different lineages. Upper Paleolithic Europe did not go to Australia. As we already know, [ENA, WHG, ANE] share more alleles/related to eachother than they are to Basal Eurasian.

Unknown said...

@WheninRome

I just don't see how the term Caucasoid applies to human populations that old. So called Caucasoid features have been associated with humans who never left Africa to begin with. I know these racial classifications have their uses. The Brace et al study you linked is one that I am familiar with. The point of Brace et al was to figure out whether or not the neolithic revolution in Southern Europe was associated with population movements from the Middle East. The point of this study, on the other hand, was to shoe-horn an Upper Paleolithic human sample into a shallow racial classification that makes no sense, considering the time period in question. Classical "Caucasian" features probably had not fully formed within that time period.

I sincerely believe this is "feel good' science where White scientists are glibly claiming that this Upper Paleolithic are us. Reminds me of Brace et al(2006) mocking the idea of Cro-Magnon are us.

Unknown said...

''So called Caucasoid features have been associated with humans who never left Africa to begin with" What population are you referring to?? The Khoisan? seems like you are coming up with stuff. Plus as I advised before OOA is just a hypothesis so without ancient dna it is possible all African populations come from the Persian Gulf or somewhere. You cant use modern dna to show where people were 40kya and people only use modern dna to support the OOA hypothesis with no ancient dna evidence. If you want me to explain why look at my previous post and tell me how OOA if a fact. You can try but you can't because the evidence just isn't there.

But from your posts you seem like you study features. I don't study features I only study genetics. Is a bat a bird? Of course given that you only study features you probably know nothing about genetics and care nothing about it just like I know nothing about features and am bored to death when anyone talks about it.

Davidski said...

@Jackson Neptune

I'm not really sure what your objections are to this paper? Are you saying that the results are erroneous? If not, then are you saying that they don't warrant much attention?

But wouldn't you agree that if they're correct, then the fact that there's genetic and morphological continuity in Europe for 37K years is at least very interesting, and perhaps valuable to understanding human genetics and morphology?

Here's a quote from Fu et al. 2016. 37K years sure is a long time. So unless you have some sort of political or social objection to this type of work, then what's the problem?

Among the newly reported individuals, GoyetQ116-1 from present-day Belgium is the oldest at ~35,000 years ago. This individual is similar to the ~37,000-year-old Kostenki14 and all later individuals in that it shares more alleles with present-day Europeans (for example, French) than with east Asians (for example, Han). In contrast, Ust’-Ishim and Oase1, which predate GoyetQ116-1 and Kostenki14, do not show any distinctive affinity to later Europeans (Extended Data Table 6). Thus, from about 37,000 years ago, populations in Europe shared at least some ancestry with present Europeans.

When_in_Rome said...

@Jackson Neptune

The term can apply to old populations, if you are trying to understand how modern phenotypes evolved from older ones. The idea is that if modern populations descend from previous ones, then the older samples should show some type of transition from archaic craniometrics to present ones seen. Claiming this sample to be caucasoid simply means that it statistically matches modern populations that you would define as caucasoid, which in turn suggests that modern populations would have descended from either this sample or a related population, since they share common features. In other words, this sample was transitioning into a population we'd call caucasoid. Perhaps referring to it as proto-Caucasoid or transitionary Caucasoid would be more accurate. As for similar features from in situ ancient Africans, they are still different. Since they are all ancient, we see common features. However, Eurasian (and African) samples begin transitioning away from the old type and into a new one. The point of this study was to correct previous evidence. New evidence came out that altered the theory. The authors are not trying to shoe-horn Kostenki14 into discrete racial categories. Rather, they are doing the same as Brace, et. al. and trying to see where this sample fits in our migratory models. Of course classical caucasian features didn't fully exist at this time period, at least none that I know of. However, the transition was begining to take place.

You said: "I sincerely believe this is "feel good' science where White scientists are glibly claiming that this Upper Paleolithic are us."

If you believe this, then I don't know what else to say. It would mean you believe in a conspiracy of white people hiding evidence. I don't see how this thought process is helpful to anyone, since it means that you would believe that whites are embarressed of their ancestry. I've heard this claim before by Afrocentric people on other forums. In fact, by believing in this, it means that you would believe in "feel good science" yourself, since you would just brush off evidence you don't approve of, and instead claim its a conspiracy to hide the "truth about black people of Europe" or some other idea. Instead of simply believing that this is a conspiracy, try questioning the methodology used to determine the results or the conclusion. By "us", I take it as you mean white people are trying to claim paleo-Europeans. I may have misundertood what you meant. But, if so, hypothetically, if paleo-Europeans all had the same skin color SNPs as modern West Africans (which they didn't) and the same craniometrics and body proportions as West Africans (which they didn't), they would still be Europeans genetically and ancestral to Modern Europeans. Black people do not get to claim a population just because they look phenotypically like them. These paleo-Europeans are not the ancestors of Africans. If anybody gets to claim them, then its White people since they are closest genetically.

Gioiello said...

@ John Smith
"@MazT OOA probably did happen but no ancient dna proves it did. C1a and K2a were found in upper paleolithic Europe. People moved a lot. Modern dna is useless for saying were people originated more than 35kya. Fact. We don't know where humans originated without ancient dna from the places we think they originated. OOA is just a hypothesis and will remain so until ancient dna either proves it or disproves it. Get over it. If I told you K2a, C1a, C1b was found in Upper Paleolithic Europe as well as M and U6 mtdna five years ago you would have told me I was crazy. And don't bring up Mota he is 4kya old he is about as useful as a modern sample".

"you would have told me I was crazy": not me. I am not an expert of autosome, but I wrote that just that could be a proof in favour of the Shi Huang and colleagues theory, and many times I remembered the fact that when Anatole Klyosov said that there wasn't any link between A00 and A0-t was defined a "racist" from evryone.

Samuel Andrews said...

Jackson Neptune makes a good argument. But it's not good to speculate on the motivation of the authors.

I honestly don't think they made this paper to prove Kostinki14 looked white. I think they chose to reanalyse Kostinki14 because old work on his morphology showed affinity to Oceania populations but his DNA shows he is most similar to Europeans.

We might be surprised by how old the origins of modern genetic and phenotype diversity is. We have no basis to say what age estimate are too old and what age estimate are too young.

Gioiello said...


"The man from Kostenki shared close ancestry with hunter-gatherers in Europe—as well as with the early farmers, suggesting that his ancestors interbred with members of the same Middle Eastern population who later turned into farmers and came to Europe themselves. Finally, he also carried the signature of the shadowy western Asians, including a boy who lived 24,000 years ago at Mal’ta in central Siberia. If that finding holds up, the mysterious DNA from western Eurasia must be very ancient, and not solely from a wave of nomads that entered Europe 5000 years ago or so, as proposed by researchers in September."

This, with the Mr Reich conference, is the true premise to the next BB behemot... and I don't say here what I wrote on eng.molgen, in respect to Davidski and his blog.

Karl_K said...

@Gioiello

The conclusions in that paper have already been clarified as totally false. Read 'The genetic history of Ice Age Europe' by Fu et al.

Both I and Davidski have already mentioned in and quoted from it within the last 20 comments.

Karl_K said...

@Gioiello

The conclusions were based on the incorrect assumption that later populations did not have admixture with East Asian populations. That was a false assumption. Either there was direct admixture, or a 3rd population later contributed to both.

All of the authors have agreed that this is true. They just didn't have enough high quality ancient samples at the time.

Gioiello said...

@ Karl_K

What you say will be also true, but it does mean: no R1b-L51 in aDNA Eastward Italy, as my map demonstrated already many years ago.

Tobus said...

@John Smith: "OOA is just a hypothesis"

It's not "just" a hypothesis, it's the _only_ hypothesis that fits the data without pleading a special case. In terms of mtDNA you have 6 branches of L, 5 of which are solely African and predate the evidence of AMH in Eurasia, the mtDNA of which is all under the 6th branch... for humans not to have originated in Africa there'd need to be 5 highly divergent groups living in the Middle East for up to 200,000 years and then all migrating into sub-Saharan Africa sometime in the last 40,000 years, both 100% completely replacing the existing AMH in Africa (the ones that left fossils) _AND_ being 100% completely replaced by the 6th branch (the ancestors of all non-Africans), so that no genetic evidence of either replacement remains. It's technically possible, but it's this kind of "technically possible" argument that makes people believe that aliens built the pyramids or that NASA faked the moon landings.. it requires a special set of events that there is zero evidence to support, and that are directly contradictory to the events that evidence we _do_ have suggests.

Ric Hern said...

What do we know about the Australian Study (Not Genetic) that points towards the "Hobbits" found in Southeast Asia not being related to Homo Erectus but rather to Homo Habilis ?

Gioiello said...

@ Tobus
"@John Smith: "OOA is just a hypothesis"
It's not "just" a hypothesis, it's the _only_ hypothesis that fits the data without pleading a special case. In terms of mtDNA you have 6 branches of L, 5 of which are solely African and predate the evidence of AMH in Eurasia, the mtDNA of which is all under the 6th branch... for humans not to have originated in Africa there'd need to be 5 highly divergent groups living in the Middle East for up to 200,000 years and then all migrating into sub-Saharan Africa sometime in the last 40,000 years, both 100% completely replacing the existing AMH in Africa (the ones that left fossils) _AND_ being 100% completely replaced by the 6th branch (the ancestors of all non-Africans), so that no genetic evidence of either replacement remains. It's technically possible, but it's this kind of "technically possible" argument that makes people believe that aliens built the pyramids or that NASA faked the moon landings.. it requires a special set of events that there is zero evidence to support, and that are directly contradictory to the events that evidence we _do_ have suggests".

Of course what you say merits to be taken into account, and its what all the Outofafricanists say, but, as for the Y, yours is the tree as to the outofafricanist theory. If we construct again the tree as to the Shi Huang and colleagues principals, at the top wouldn't be L0 but L3, as for the Y not A0-T but F. I didn't say that this is true, because I haven't so far checked this theory. I said only that it merits to be examined. Anyway Africans have Y A00 (separated 300000 years ago as to Shi Huang from A0-T), and they say that also ABCDE are downstream F and not upstream. Of course the tree of the Neanderthals and Denisovans tested should be constructed as to these principals and see if they are in the range of A00/ABCDE, what isn't easy to do just for the low coverage of old samples.

Karl_K said...

The Y tree as to the Shi Huang and colleagues has a number of obvious problems.

First, instead of using all of the raw full sequence data, they select only the SNPs that make the tree fit their model. Second, they root the tree in an arbitrary fashion, not taking into account obvious outgroups. You don't need Neanderthal or Denisovan, because you can use Chimpanzee, Orangutan, and Gorilla as the outgroups. From these full sequences, the ancestral allele for nearly every human SNP can be determined, even on the Y and mtDNA. Unlike on the mtDNA, probably greater than 99.9% of SNPs on the Y and autosome are unique neutral events with zero possibility of reversion.

They try to get around this by claiming that African humans are "closer to chimpanzees". This is the most insane conclusion possible! The only way that could be possible is through admixture, which is firstly impossible due to chromosome number differences, and secondly would be so obvious that it would be totally unquestionable if true. And it is anything but! Anyone could cherry pick a large set of SNPs that are unique to Eurasians, that would make Africans cluster with Chimps. But it is an artifact of selecting only those SNPs. The full sequence leaves zero doubt that all humans (including Neanderthals and Denisovans) cluster together to the exclusion of all other apes.



Karl_K said...

@Ric

That study on the hobbits is nothing more than a guess. Just look at the track record of these things. Kostenski14 is melanesian. Kennewick man is polynesian. Whatever.

In this case, they are looking at a very morphologically divergent species in a remote location, that likely underwent extensive drift and selection on a small island for (probably) tens of thousands of years. There is no way that they can compare this to a few very different skeletons from other locations and be correct on a species level. And the total lack of other evidence from anywhere in Eurasia is a major problem for such a bold claim.

Ric Hern said...

@Karl

Thanks

Davidski said...

@xyyman

I won't let you post here unless you quit being a total dickhead.

Kostenki14 doesn't have Basal Eurasian admixture. This was established in Fu et al. 2016.

Quit citing the older study that says otherwise, and update yourself.

xyyman said...

^ I never said KOS14 had basal Eurasian. In fact that proves my point. But answer me this. Can anyone shed some light on this? From the Orlando et al . Aren't Australo-Melanesians part of Eurasians?

Quote:
"The ancestors of contemporary Eurasians are believed to have left Africa some 60,000-50,000 years ago (60-50 ka) (1, 2), possibly 30-40 ka LATER than Australo-Melanesian ancestors (3). Despite"


---
Dedicated to the delusional

---
Abstract.
The origin of contemporary Europeans remains contentious. We obtain a genome sequence from Kostenki 14 in European Russia dating to 38,700 to 36,200 years ago, one of the oldest fossils of Anatomically Modern Humans from Europe. We find that K14 shares a close ancestry with the 24,000-year-old Mal’ta boy from central Siberia, European Mesolithic hunter-gatherers, some contemporary western Siberians, and many Europeans, but not eastern Asians. Additionally, the Kostenki 14 genome shows evidence of shared ancestry with a population basal to all Eurasians that also relates to later European Neolithic farmers. We find that Kostenki 14 contains more Neandertal DNA that is contained in longer tracts than present Europeans. Our findings reveal the timing of divergence of western Eurasians and East Asians to be more than 36,200 years ago and that European genomic structure today dates back to the Upper Paleolithic and derives from a meta-population that at times stretched from Europe to central Asia.


---

This I agree with. Which is what Lazaridis meant when he said modern Europeans have three ancestral population. KOS14 and other ancient Europeans were not true CXXX( I hate saying the word). But the final element was brought in by African Neolithic's which complemented or completed MODERN Europeans. Coon was correct and basically is in line with genetics that Neolithic either originated in the Arabian Peninsula or somewhere in East Africa. Sergi suggested Sudan. We know basal Eurasian in African which comprises 80% of modern Europeans.
----
Blogger Anthro Survey said...
I would refrain from labeling him as Caucasoid because I don't believe the true Caucasoid morphology was a reality until two ancestral clades mixed: western Upper Paleolithic Eurasians and Basal Eurasians. Hence, I believe the first true morphological Caucasoids were probably to be found among Natufians or CHGs.

Now, Kostenki and Loshbur for that matter do have many common motifs with modern Caucasoids. No question about this.

But, then again, most modern populations where the Caucasoid morphology is in the majority are >50% western upper paleolithic. Even peninsular Arabs.

Kostenki's shared traits with modern Mongoloids or Australoids can be explained by thr fact that ENA/ASE and ANE/WesternHGs were sister branches.


German Dziebel said...

@Tobus

My old friendster is back and he is back with his old nonsense.

"It's not "just" a hypothesis, it's the _only_ hypothesis that fits the data without pleading a special case."

Out-of-Africa was created before the data has even been accrued. Since then it has been modified a couple of times (e.g., no-archaic admixture-outside-of-Africa claim dismissed) and now is being challenged outright. This is the reality. Out-of-Africa doesn't fit the data: the data has been generated to fit it but it just doesn't. Too bad, it's taking the data longer to upset a theory than for a theory to summon the data.

Karl_K said...

@German

"This is the reality. Out-of-Africa doesn't fit the data"

That is not the reality. It fits the data for all of the Y and mtDNA, and >90% of the autosome.

It is generally true, with the caveat that out-of-Africa populations have additional admixture from Neanderthals and Denisovans, and maybe some Africans possibly have some admixture from unknown human relatives, but we can't say for sure without more sampling or ancient DNA from Africa.

This is the general consensus that fits the nearly all of the data as we have it today.

German Dziebel said...

@Karl_K

Yes, it's the Western consensus. The Chinese just challenged it, so, again, logic requires that you stop reciting your out-of-Africa poem and question whether the poem is actually grammatically correct.

Karl_K said...

@ German

They challenged it with nonsense, and you look past it all, because you don't care if it is nonsense. The reason it is the Western consensus is because it fits the data the best.

Davidski said...

@xyyman

You just quoted an outdated paper so I deleted your comment.

Fu et al. 2016 is a more recent reference for Kostenki14 stuff.

German Dziebel said...

@Karl_K

How is it nonsense? Please show. You mentioned somewhere that they cherry picked SNPs? Have you seen an mtDNA tree? Did you notice all the recurrent mutations there? All the clades defined by highly variable sites? They just cleaned them up by focusing on what they claim are slow-moving sites that they hypothesized are such by looking at macaques. This is all fine, as far as I can see.

If you want tot challenge them, you need to show why those sites are not slow-moving, align a macaque sequence next to a chimp sequence next to a human sequence, etc. They do make mistakes in data capture but you have to get dirty with the data yourself to justify your dismissal. Science is not about voting for your favorite candidate!

Karl_K said...

@German

"You mentioned somewhere that they cherry picked SNPs? Have you seen an mtDNA tree? Did you notice all the recurrent mutations there?"

I clearly stated above that only the autosome and Y were >99.9% free from back mutation, not the mtDNA. And I have absolutely no problem with their mtDNA phylogenetic tree, except that they chose the root to fit their model. Where do the dozens of complete, high quality Neanderthal and Denisovan and Ape mtDNA sequences fit on that tree? I would guess... right next to the human L haplogroups, making them all derived quite recently from modern Asian humans.

German Dziebel said...

@Karl_K

"And I have absolutely no problem with their mtDNA phylogenetic tree, except that they chose the root to fit their model."

They - and I - chose to root it in such a way not because it fits their model but because it fits what's actually attested. Hg R is the most wide-spread/common macrohaplogroup that's attested in the most ancient aDNAs found across Eurasia to date. So we have to assume that, for modern humans, it's ancestral. This may be falsified if, say, Hofmeyr skull in South Africa dated at 36,000 turns up DNA that would contradict this pattern. But this is unlikely considering that it clusters with Eurasian skulls and not with anything African.

It's only because of the decades of well-funded Western lab-labor, which have created an impression that we don't need simple evidence and logic to bolster our phylogenies, that simple-minded consumers like you can't see the forest for the trees anymore. :)

Karl_K said...

@German

"Hg R is the most wide-spread/common macrohaplogroup that's attested in the most ancient aDNAs found across Eurasia to date. So we have to assume that, for modern humans, it's ancestral."

No. We do not have to assume that at all. That is not how it works. This isn't a popularity contest. Science is not about voting for your favorite candidate.

Being widespread and from an ancient split has no bearing on being genetically ancestral to all other lineages.

German Dziebel said...

@Karl_K

"Being widespread and from an ancient split has no bearing on being genetically ancestral to all other lineages."

No, this is what a hypothesis of ancestrality looks like. Then you test it against incoming data and see if it gets falsified. Trees rooted in Africa are not even testable hypotheses because it's unclear why would we nominate rare, geographically restricted lineages found only in Africa to be basal to all of modern humans. Unless of course we are operating under an out-of-Africa bias. Then it would explain it all.

Karl_K said...

@German

How do you think phylogenetic trees are constructed for the 99.9999% of species with zero ancient DNA information?

This is not some kind of voodoo magic. In fact, in nearly every case, no ancient DNA is needed. Only when a single population very rapidly diversifies, and then many branches survive, would this be helpful at all.

So, for a few spots on the human tree, this could help. For all the rest, it is not needed. For the very deep African splits, it is not needed at all.

German Dziebel said...

@Karkl_K

What do you mean "not needed"? Who doesn't need it? For what purpose?

Modern humans furnish us with the absolutely richest datasets (ancient and modern, genetic and phenotypic, cultural and molecular) relevant to understanding how evolution works. It would be a remiss for a sapient species such as ours to not use them to understand its origins and instead to hope for divine revelation from navel-gazing at nature using small, simple and synchronic drosophila datasets.

Karl_K said...

@German

By 'not needed' I mean that that no amount of ancient DNA could change the tree. Of course it could add dead lineages, which could be useful with autosomal DNA analysis of admixture, but nonetheless, the tree of haplogroups would not be altered.

German Dziebel said...

@Karl_K

"no amount of ancient DNA could change the tree...the tree of haplogroups would not be altered."

Are you talking about the biblical tree? Because a genetic tree can easily be altered if it turns out that for a species in question it went A > G at site 56089 and not G > A, or if it turns out that site 38787 is too mutable to infer a pattern and has to be skipped therefore.

I'm getting tired of proving that I'm not a robot.

:)

Karl_K said...

@German

You keep falling back into your safe space of mtDNA reversions. It is a little sad. Please open your eyes to the millions of autosomal and Y SNPs that nearly never have this problem, because they are not under heavy selection.

Just open your eyes, and then you can see!

Karl_K said...

@xxxyyymannn

I know this will be deleted, and you are probably crazy and in need of serious help.

But, you are right about a few things. There are also people like German who go overboard the other direction.

I think you will actually be happier if you learn about the basics about population genetics and molecular genetics.

Samuel Andrews said...

@Gioiello,
" If we construct again the tree as to the Shi Huang and colleagues principals, at the top wouldn't be L0 but L3, as for the Y not A0-T but F."

That Chinese study's mtDNA and Y DNA trees are wrong. Plain and simple, they're wrong.

Karl_K said...

@Samuel

I think maybe directing them to very basic textbooks might be better than arguing.

German Dziebel said...

@Karl_K

"You keep falling back into your safe space of mtDNA reversions. It is a little sad."

mtDNA is the simplest example you can understand. The rest is even less out-of-Africa-like than mtDNA. Y-DNA has long had a better trail into Africa than mtDNA (hg E as a subset of hg CT) At best, you could argue that there was admixture with archaics in Africa, hence Africans are often seen pulled toward chimps in whole-genome studies.

Samuel Andrews said...

@xxyman,
"Autosomally KOS14 is Asian. Of course Northern Europeans are more Asian/ANE/HG than southern or westerner European . The Neolithics essentially admixed and diluted the ancient HG Europe starting from the south/Sardinia/Iberia. Yes, Europeans share ancestry with KOS14 because all humans share ancestry including Africans"

European HG isn't the same as Asian. Not even close. Asians are more related to European HG than to Middle Eastern HG-farmer but European HG is moe related to Middle Eastern HG-farmer than to Asians. And modern Euopeans are a mixture of the two, and therefore Kostinki14 is much more related to Europeans than to Asians.

Read the links Davidski provided. Kostinki14 is most closely related to modern Europeans. There's no ifs or ands about this, it's fact.

http://eurogenes.blogspot.com/2014/11/kostenki-14-perhaps-not-what-i-expected.html

German Dziebel said...

@Karl_K

"I think maybe directing them to very basic textbooks might be better than arguing."

Looks like you can't talk yet, only point.

It's a joke!

Gioiello said...

@ Samuel Andrews

"@Gioiello,
" If we construct again the tree as to the Shi Huang and colleagues principals, at the top wouldn't be L0 but L3, as for the Y not A0-T but F."

That Chinese study's mtDNA and Y DNA trees are wrong. Plain and simple, they're wrong".

Are you certain about that as to that R1b1a2-L51 came from Yamnaya?

Karl_K said...

@Gioiello

You are arguing with the wrong paper. This one is garbage. Find a better one to reduce the noise.

Samuel Andrews said...

@German Dezibel,
"a genetic tree can easily be altered if it turns out that for a species in question it went A > G at site 56089 and not G > A, or if it turns out that site 38787 is too mutable to infer a pattern and has to be skipped therefore."

I know what you and that Chinese paper are arguing: The accepted mtDNA tree tries to make sense of a jungle lot of mitochondrial mutations. It's up to interpretation which mutation came first and therefore the structure of human mtDNA tree. The branches of the human mtDNA tree believed to be most basal could be mutated versions of their believed to be daughters.

^^
Allow me to explain how the human mtDNA tree was constructed.....

Researchers analyse 1,000s of human mtDNAs. They discover 1,000s of SNPs. They discover that almost every human mtDNA is distinct. To deceiver the relationship between all of these human mtDNAs researchers look at what certain mtDNAs share in common.

The group finds that 100 mtDNAs share identical alleles in 50 SNPs and ten of those one hundred mtDNAs share identical alleles in an additional 10 SNPs that means the 50 SNPs came before the 10 SNPs. Then the group finds 200 other mtDNAs which share identical alleles in 30 of those 50 SNPs, that means the 30 SNPs came before the other 20 SNPs.

They kept doing this until they constructed the mtDNA tree we have today. If mHG R is ancestral to all Eurasian mtDNA, like you are arguing, then why doesn't mHG R carry mHG N and R mutations like mHG R does? For what you're arguing to be true, that the human mtDNA tree is completely, there'd have to be 1,000s and 1,000s of back mutations and whatever other impossible shit.

^^
I have literally looked through the rCRS and RSRS mutations of 10,000s of mtDNA samples. I have discovered 1,000s of little human mtDNA haplogroups.

Look at the haplogroups I discovered in Finland.
http://mtdnaatlas.blogspot.com/2017/01/finland.html

And Southern Africa.
http://mtdnaatlas.blogspot.com/2016/11/insights-from-600-southern-african-mito.html

So I know what you and that Chinese team are arguing is complete baloney. There is a 0.000000000001% chance that the current human mtDNA tree is false. Actually there's a 0% chance.

No one buy into German Dzebial's bull crap!! If I wanted to waste my time writing a pdf or making a youtube video articulating why he is full of crap I would but I don't like to waste my time.

Gioiello said...

@ Samuel Andrews

I said that I didn't the work you did, only that that theory merited to be verified. Anyway what you say demonstrates that the criterion used from these scholars (I said how ridiculous are the tree and the dates of Behar & Co.)was only the frequency, whereas Chinese used that of the mutation rate. Two methods completely different.

German Dziebel said...

@Samuel Andrews

You just made 4 mistakes trying to spell my family name twice. For some reason, this makes me hesitant to trust the accuracy of your rendering of literally millions of genetic positions on the human family tree.

@Karl_K

Another joke!

Gioiello said...

@ Karl_K
Sample: #YF02873 (R-FGC24408) ChrY position: 16557133 (+strand) Reads: 21 Position data: 21G Weight for G: 1.0 Probability of error: 0.0 (0<->1) Sample allele: G Reference (hg19) allele: G Known SNPs at this position: M697 (G->A)
Reference sequence (100bp): ATAGATGAGGATGGACATGGGGGATCTGGGGAGAGGGAAGCATAACCCAG
G AAGCCAATATCCCATTGCCACAGGCTGAGAAAAAAAGGATCCTAATGTAC
(16557082-16557183)

This SNP is unreliable, anyway you aren't an African neither a Vietkong. You are joking me, but you don't know that I am vendicative.

capra internetensis said...

The Chinese guys just pre-set the roots of the uniparental trees to be where they wanted them to be. It was not a result but an assumption.

German Dziebel said...

@capra

You are blatantly wtong. The new tree was rooted on the basis of objective factors of antiquity, distribution and frequency. An out of Africa root, on the other hand, was picked because the African origin was gaining some popularity in some scholarly circles. Open Johnson et al. 1983 and see for yourself.

Karl_K said...

@capra

Yes. You are correct. We already went through this...

batman said...



@ Karl

One better not fall for old, outdated "views" or "consentual opinions" in discussing the new amounts of facts objectively. Several new results within paleo-archaeology, paleo-biology, paleo-climatotology and glaciology are already challenging the the old OOA-modell. Which is why many within the professional communities are now re-considering the alternative Multiregional-modell.

The genetic information shedding light on these matters are ALL very new, as is the profession Genetics in general - and the models of Human Genetics, specifically. Insisting on the OOA-modell - to avoid structuring the Human Genome according to a MR-modell - is anything but logic. Not to say scientific.

batman said...

Anyone with a basic understanding of the Middle Paleolithic and Late Paleolithic industries from the arctic parts of Eurasia KNOWS that there's a clear-cut continuum between these periods, as examplified by the "Mousterien/Szeletian techno-complex".

Concerning genetics we have known samples only from the latter period, starting with Ust-Istim at 45.000 BP. These y-dna K2* may have disappeared already during the smaller coldphase at 42.000 BP. Though - somewhere along the continent their ancestral CT-bearers obviously survived - to show up in the warmer interstadial between 37.000 - 30.000 BP; in Kostenki 14 and 12, as well as Goyet q-116, Paglicci, Cioclovina, Pavlov and Dolni Vestonice.

If the present structure of the Human Genome is anything to go by we should find y-dna C1/CF as a result of a paleolithic population placed north of the Alps and the Pyrenees.

Which indicates that the early brother-lines of CF, like y-dna E, should be found south of the arctic climate-zone. The oldest known examples of y-dna E found along the southern shores of the Med seem to verify this assumption, thus confirming said modelling.

Macro-group C1/CF seems to be the one that were able to adapt to a high-arctic climate. Such as the 40.000 years old site at Mamontovaya Kurya at the Arctic Ocean and the 30.000 yrs old Yana RHS at the 71th paralell - as well as Kostenki, Sunghir, Dolni Vestonice, Hohe Fells, Grotta Fumane and Abri de Cro-Magnon.

Thus we have a archaoleogical AND a genetic continuum across the arctic climate-zone - running paralell through the Late Paleolithic, down to the decimation of the Glaciaol Maxima.

Thus we have THREE corresponding elements connecting the Mousterien/Szletien to the Aurignac/Gravettian/Solutrean.

Due to the palearctic genome it's pretty clear that the "Cro-Magnon-type" is "proto-Caucasian", rather that "proto-modern". Whcih means that the term "modern" is an old anachronism, using the back-mirror to look ahead.

Seemingly we have to ascribe ALL descendants of C1/CF/CT as descendands of the same, arctic population. Which means that Ust-Isthim as well as Pestera de Oase, both CF->K2*, are off-spring of the same CT that made it to Kostenki, Sunghir and Malta BEFORE the decimation of LGM - then to re-appear during the Billeroed interstadial at Afontova Gora, Hohe Fells, Schwaben and Bichon, as well as Rochedane and Goyet (q2) - producing the inter-stadial techno-complex known as Magdalenien/Hamburg.

Along with Ust Isthim/Pestera Oase it seems that 99% of all other, arcitc off-springs from the Paleolithic CF-line also disapeared, creating the long known "bottle-necks" at the end of ice-time, as described by Phinasi et al, where LGM decimated most populations of large mammals and the following Dryas-periods extincted 2/3 of the pale-arctic megafauna.

Which means that we have to look further west for SOME surviving refugiants - to explain how CF could survive - up north - from where they spread and developed into CT, as in F->GHIJK/LMNO/RST, as soon as the megafaunal extinction at the end of ice-time was over and the Eurasian continent became available, again.

As far as facts are concerned, the origin of makrogroup CF/CT/F can be located to the arctic hemisphere of paleolithic Eurasia. We further know that this genome went through a severe bottle-neck, to produce the caucasian CT-lines that repopulated post-glacial Eurasia - Along with the mt-dna that survived and spread along with these men, based on mt-macrogroup N.

It's also clear that these "caucasians" ('asi'/'aser'/'asur'/'ari'/'arya') started mixing with the tropical populations that survived ice-time south of the 40 paralell. In Africa as well as Asia AND America, seemingly. Which for some funny reason is described by various I-E, Chineese and Amerindian myths and legends, as described by prominent mythologers like Tilak and Warren already at the start of the 20th century.

Tobus said...

@German:

If you remember the last time we discussed this, I took your suggested "reversed" mutations and applied them to the mtDNA trees of AMH, Chimp, Neanderthal and Denisovans. I quickly found that the number of discrepancies (double mutations) required skyrocketed, and after applying the reversals up and down the tree a short way I ended up with at least an order of magnitude more "problem alleles" under the reversed model than with the accepted one. It turns out that an mtDNA tree rooted in Africans genuinely is the best fit.

I know you don't like doing genetic groundwork, but I strongly suggest you do this excercise for yourself - it will only take about an hour of your time and you will be all the smarter for it.

German Dziebel said...

@Tobus

You were delusional then and you are delusional now. (It's funny how out-of-Africa stalls people's wits). Your half-and-hour-long genetic "groundwork" is of no interest to me.

Tobus, Capra and Karl - three new characters for Elmo's World.

Anonymous said...

Reading the full-paper now and it sounds like all they're saying is that he didn't look much like Papuans or Melanesians. They don't say he looks like modern Europeans or something:

"The position of the Kostenki 14 man in the CV I–II space is illustrated by a graph (see Fig. 1a): this individual,by the sum of craniometric indicators, is unambiguously characterized by the European complex of characters and shows no noticeable deviation toward tropical groups. Note that we are not speaking about its full similarity to any individual ancient European series. On the contrary, the results of our analysis show a sufficiently noticeable anthropological distinctness, which CV IV demonstrates (see Table 1). It separates the Kostenki 14 individual from all the series included in the analysis (see Fig. 1b). The size of differences is very great, amounting to 43% of the total variability range according to CV IV. This vector practically fully depends on one character, namely, the nose height, which is extremely small in the Kostenki 14 individual. Interestingly, the face height in this case is of little significance."

They just seem to have found that K14 was more like some neighboring Upper-Paleolithic individuals rather than "Australo-Melanesian"-like in appearance and we know these Upper-Paleolithics were distinct from modern West-Eurasians already and that Europe's craniometry was altered thanks to things like the farmer migration:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1325007/

You got a little ahead of yourself, David.

batman said...

Orion,

"...we know these Upper-Paleolithics were distinct from modern West-Eurasians".

Which Upper-Paleolithics do you refer to?

"Europe's craniometry was altered thanks to things like the farmer migration"

Migrations may alter craniometry, as can exogamy. Some Sino-Tibetan woman marrying some Finnish and Scandianvian farmers, as of 7.500 years ago, would certainly change some craniometry by itself. The continous impact of this communication until modern time - along the arctic facade - can still be found among the Finnish lapplanders, today recognized as the Sami population.

It's more unclear, though, if the spread of farming had any such impact. Especially as the first farmer may have developed and migrated OUT of Europe.

Karl,

You may enjoy checking what Venter et al have to say about the complexity of the human genome. Apparently there is still some important groundwork left to be done.

http://www.pnas.org/content/113/42/11901.full

Plains Wanderer said...

From genetics we know that Kostenki is near the base of West Eurasians. Therefore I would expect him to be on the path to becoming West Eurasian in appearance. This doesn't mean he looked like a modern European of course, but it shouldn't be surprising that he shows some increasingly West Eurasian traits. Similarly, I would also expect Tianyuan Man to be on the path to becoming East Asian in appearance since, like Kostenki, he lived not long after the split between East and West Eurasians. This doesn't seem controversial to me.

Hector said...

As entertaining as ever.

All that staggering variety of C1a C1b C2(formerly C3) F* K2a K2b lineages all started from Europe and made independent arduous journeys all the way to far reaching places as east as Oceania while being nearly extinct(except some back migration of a tiny sublineage of K2b) in the European homeland...

In the meantime the supposed "original" East Asian Y haplogroup D entirely lost out, gave up their women to the European studs and became extinct in Sundaland, Australia and SE Asia and most of East Asia except in Japan and Tibet. LOL.

Davidsky's erasing this post will not restore the lack of scientific common sense pervading this blog.

Davidski said...

Hello Hector, how are you? Added any Math Olympics medals to your collection since we last spoke?

Hector said...

It is Olympiad. Did you finally pass Calculus? Most of us finished it in 10th or 11th grade.

Nirjhar007 said...

Okay so lets have that BB paper today (?)

Tobus said...

@German: Your half-and-hour-long genetic "groundwork" is of no interest to me.

Surprise, surprise :)

Samuel Andrews said...

@German Dziebel,

Tobus's work confirms that the currently accepted human mtDNA is correct.

Karl_K said...

@batman

"You may enjoy checking what Venter et al have to say about the complexity of the human genome. Apparently there is still some important groundwork left to be done."

Thanks batman, but what does this have to do with any discussion here?

They just say that each individual human has around 8,000 novel SNPs, and 0.7 Mb of unique DNA sequence.

That does not change anything about phylogenetic trees, or Kostenki, or anything else that anyone here is talking about.

Matt said...

Hector: All that staggering variety of C1a C1b C2(formerly C3) F* K2a K2b lineages all started from Europe and made independent arduous journeys all the way to far reaching places as east as Oceania while being nearly extinct(except some back migration of a tiny sublineage of K2b) in the European homeland...

It would be wise not to take "batman" as representative in any way of this blog. He is, shall we say, an "eccentric" voice among its commentariat. (I can only assume this is a response to his postings, as otherwise it is a non-sequitur).

Though for practical purposes, on your comment, the substructure within each of C, F and K you talk about happened before the earliest evidence of colonisation of Europe by AMH (at Pestera Cu Oase with significant admixture from Neanderthal) - https://link.springer.com/article/10.1007/s00439-017-1773-z. I would guess more likely to have occured in an unstructured Eurasian population, or in a structured set of populations within Eurasia whose structure cannot be articulated from any modern day structure. Probably population(s) living in Central Asia or South Asia, not East or Southeast Asia, on the basis of geographical parsimony. Hopefully the Tianyuan man adna will give us more information to think about this. It may be a question (which populations did these y-dna groups originate in?) we find hard to say anything real about.

batman said...

"the substructure within each of C, F and K you talk about happened before the earliest evidence of colonisation of Europe by AMH"

Eccentric or not, this was my point quite exactly. Accentuating the question of WHERE the branching of the arctic C-line happened, to create the extinct and extant substructures of the arctic CF/CT...

Since the y-part of the aDNA from Ust Isthim and Pestera as well as Kostenki and Goyet are downstream of CT you may have to explain;

1) If CF/F where "AMH" - or rather "proto-Caucasian", already.

2) If there are any evidence that this diversity happened "before AMH arrived in Europe" (aka northern Eurasia).

3) How the various lines of CF (C, F-K) arrived via various routes and at various times - to the arctic part of the world.

4) Who populated the extreme climate-zones of the high-arctic north, already 45.000 years ago.

The latter point was rised by Pavlov et al already 2001 and repeated by John Hawks 2005.
http://johnhawks.net/weblog/reviews/early_modern/arctic/pavlov_2001_arctic_europe.html

Since the sequencing of Kostenki and Ust Istim the question have clearified somehow, as the off-spring of y-dna C, as in CT, seems to be an important part of the answer.

If archaeology, paleontology, climatology and evolutionary biology is anything to go by, we may still have some work to do, not to end up with bunches of exceptional eccentricities. Using the dogmatic modell of OOA is obviously not satifactory.

batman said...

Adding some scientific common sense may help:

"Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences"
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4884158/

In the Indian subcontinent maternal lineages primarily is known to reflect Paleolithic origins, while paternal lineages predominantly reflects influxes from the last 10.000 years.

The genetic influx from Central Asia during Bronze Age was also strongly male-driven, consistent with the patriarchal, patrilocal and patrilineal social structure attributed to the inferred pastoralists...
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5364613/

Hector said...

"Hopefully the Tianyuan man adna will give us more information to think about this."

You give way too much credit to yourselves. Tianyuan's result will
absolutely change nothing for you guys.

If his HG is D you will claim that it is a definitive proof that native East Asian HG is D and nothing else. If it comes out to be C then you will claim C had a northern distribution ~40000 years already with an ultimate Caucasoid origin. Even if it comes out to be an early form of P you will claim that it is the earliest evidence of differential mating pattern of Caucasoid men and East Asian women which you see as repeated throughout history.

If none of these work you will try to re-analyze Tianyuan's genome and announce that he is actually an incipient West Eurasian.

Your conclusion is already set in stone. That is why it is not science.

batman said...

Strawman,

What science is it not - chineese or euro-american?

Hector said...

@batman

You don't have to announce that your ESL gibberish is a straw man every time.
It is actually something far worse. We make the determination, not you.

Matt said...

@Hector, I think I must have triggered a script in your robot brain or something, since there's no relation to anything I mentioned other than the words Tianyuan man.

I perceive no probability of future me talking about "differential mating pattern of Caucasoid men and East Asian women" at tens of thousands of years before present, nor do I see that as "repeated throughout history" (for one I am quite doubtful that either of these groups, to the extent they are even a well formed idea, existed at tens of thousands of years before present).

The quality of comments on this blog continues to degrade.

batman said...

Hectur,

So far you haven't been making anything other than ranting strawmen and blatant inuendos.

Unknown said...


I still think he was australoid admixed or part australoid due to being in the middle of process of evolving into West Eurasian.
This is backed by admixture programs showing signifcant South Asian/South Indian admixture and Kostenki14 clustering on PCAs with ASI admixed modern Pakistani populations. He may have had some basal eurasian too which is again suggested by admixture components and clustering with CHG/Iran EN admixed populations. Him looking vaguely caucasoid also makes sense as modern Pakistanis who are ~20% australoid+~10% east asian on average also have mostly caucasoid features despite having little to no WHG(0-15%), although they have a lot of ANE which contains WHG-like or probably more accurately Vestonice-like admixture.

Limb measurements suggest a tropical origin of UP Europeans which could have been directly in Africa or in prehistoric India/South Asia. That would explain ASI affinity in Vestonice and even El Miron cluster but not Villabruna cluster which was more drifted away from ENA but at the same time East Asian/NE Asian/Siberian/Austrolesian(among modern populations the mongoloid admixture in ANE, CHG, Neolithic Iran and WHG seems to be most closely related to Ami,and which also seems to be closely related to the Devil's Gate admixture present in Amerindians) admixed.

Among recent humans brachial and crural indices are positively correlated with mean annual temperature, such that high indices are found in tropical groups.

However, despite inhabiting glacial Europe, the Upper Paleolithic Europeans possessed high indices, prompting Trinkaus (1981) to argue for gene flow from warmer regions associated with modern human emergence in Europe. In contrast, Frayer et al. (1993) point out that Late Upper Paleolithic and Mesolithic Europeans should not exhibit tropically-adapted limb proportions, since, even assuming replacement, their ancestors had experienced cold stress in glacial Europe for at least 12 millennia.


This study investigates three questions tied to the brachial and crural indices among Late Pleistocene and recent humans. First, which limb segments (either proximal or distal) are primarily responsible for variation in brachial and crural indices? Second, are these indices reflective of overall limb elongation? And finally, do the Late Upper Paleolithic and Mesolithic Europeans retain relatively and/or absolutely long limbs? Results indicate that in the lower limb, the distal limb segment contributes most of the variability to intralimb proportions, while in the upper limb the proximal and distal limb segments appear to be equally variable.

Additionally, brachial and crural indices do not appear to be a good measure of overall limb length, and thus, while the Late Upper Paleolithic and Mesolithic humans have significantly higher (i.e., tropically-adapted) brachial and crural indices than do recent Europeans, they also have shorter (i.e., cold-adapted) limbs.

The somewhat paradoxical retention of "tropical" indices in the context of more "cold-adapted" limb length is best explained as evidence for Replacement in the European Late Pleistocene, followed by gradual cold adaptation in glacial Europe.

Karl_K said...

@Unknown

You are citing multiple genetic and morphological studies that have been later clarified to have been incorrect.

I honestly do not care about this specimen in any way, and he probably had close to zero impact on modern Europeans. But... just pointing out the literature situation.

Unknown said...

@Unknown
Interesting, do you have the references to the websites that your paraphrasing. I understand they are mostly incorrect and antiquated, but for me of course, I would be intrigued to read more about it.

Unknown said...

FST can be confounded easily, especially in the case of multiple divergent basal populations. I read some study that stated North Africans based on FST results if I remeber right share 3x more alleles with SSA than with Middle Easterners which is unlikely as while they have 20-30% SSA admixture the rest of it is Natufian-like admixture and some WHG. Egyptians are pretty much Natufian+Levant EN+SSA whereas Moroccans, Algierians, and Tunisians are pretty much the same but with much more WHG(10-20~) than Egyptians. All of them are more middle eastern than SSA or WHG. The type of basal eurasian in Kostenki and some other paleolithic euros is more than likely different than the one in neolithic farmers or even Iran EN but closer to the Iranian strain. I believe there were multiple types of basal eurasians.
I know admixture results are looked down upon here but paloeuropeans clearly show middle eastern, north african, and south european components ( when gedmatch calculators are used too) which can only be explained by BE-related as mesolithic HG don't show these components at all. With admixture it can go both ways of course but last but not least global PCAs show Oase1 and Ust'-Ishim near heavily ASI adivasis like Paniya and Kostenki along with Vestonice individuals near ASI/CHG/Iranian hybrids from Pakistan and North India who are significantly BE admixed. Vestonice cluster was also close to Han on Fu's PCA but that's most likely due to lack of australoids on that PCA. Australoids and mongoloids are both ENA so that can explain it.

http://www.open-genomes.org/analysis/PCA/Eurogenes_Ice_Age_Eurasians_PC_plot_1-2-3.html

https://genetiker.wordpress.com/2016/05/07/k-13-admixture-analysis-of-ice-age-european-genomes/

http://img.4plebs.org/boards/pol/image/1493/80/1493806084921.png

http://img.4plebs.org/boards/pol/image/1494/07/1494070542946.png

German Dziebel said...

@Samuel Andrews

"Tobus's work confirms that the currently accepted human mtDNA is correct."

What work?

Unknown said...

@Unknown

Thank you sir, I genuinely appreciate you providing the references from the interesting post you left.
It took some time for me to respond because I'm self-teaching myself how to understand PCA's. This means I won't be able to learn the mathematical procedure in a day. Since, I'm having difficulty understanding the x,y, and z scores which I assume represent the averaging of SNP's. The rest of the information such as the dimension are synonymous with values and I can notice from the top to the bottom of thet grid can further show you spatial variation and geographical distances among the plots and outgroups.
So anyways, the Ust'ishim and the Kotenski culturally share many similarities with Australian aborigines artifacts that have been found last ventury; for example, venus figurines have been associated with Malta Bu'ret, Ust'Ishim, and Gravettitians. I'm sure, you don't believe this to be true, but considering the possibility that ASI were proto-caucasoids some HG such as Y-dna H2b and mtdna N1a found among European possibly showing that they weren't merely 3 or 4 migrational periods but multitudes of migrational patterns that were resulting from minor influences in the genome which can't be caculated with today's technology. The reason why state this is because many of these findings of population genetics are usually generalized, and much of the information seems to be retained while many geneticist report new information although much of it has already assumed.
Honestly, I don't know what I'm taking about in regards to proto-caucasoid. Yet, I'm not sure if australoids only represent proto-mongloid populations. As they do represent a wide variety of ethnicities. Considering the possiblity of ommitting the "Out of Africa Theory."

Anyways, yeah, there may have been more than one Basal Eurasian component. Neolithic European farmers represent 44 % of Basal Eurasian. While the steppe's are showing different admixture of early farmers which may have come from Iran and Armenia. Yes, I remember hearing about this analysis on one of Reich's 2016 video's that you can find on youtube.
I apologize for wasting bandwidth but that there is merely to discuss. And many things that we don't know. And thanks again, I found the articles to push me in trying to learn more about PCA's and other statiscal methods that used in population genetics.

Unknown said...

I will look for more useful links soon.

Unknown said...


Sorry for the late response, I was busy. If you're still reading, I think initial 44% basal in EEF was debunked. They probably were around 20% basal. Modern Saudis and BedouinsB are probably around 40% basal eurasian. ASI weren't proto-caucasoids. They seem to be australoids genetically inbetween Australian Aborigenes, Negritos and Papuans or maybe even a mixed population of proto-Australians, proto-Papuans and Onge. Australia, New Zealand and Papua were once part of the continent of Sahul.
Ust'-Ishim who seems very close to original ASI does have a minor WHG shift though much smaller than Oase1. Oase1 in my opinion could have been Proto-West Eurasian due to quite high WHG/North European/North Sea components he had but FST doesn't detect contributions from Oase1 in later UP Europeans like Kostenki, Goyet and Vestonice which could mean he was from a related but different lineage than than the one later UP Europeans were from.
MA1 was only around 10% australoid/ASI. He had much higher palomongoloid admixture probably similar to Proto-Ami than he had australoid.


Allele sharing methods based on FST seem to be influenced by drift which can to large extent change allele frequencies. This is probably why FST doesn't detect basal eurasian in paleolithic europeans(but admixture methods and pcas seem to do) and might be why it doesn't detect Oase1's affinity with other UP europeans. Similar problems can be with SSA admixture in Natufians although many Africans are Natufian/Levant N admixed which confounds the results. I think treemix too detects SSA in Natufians.

Unknown said...


Kostenki's admixture

http://science.sciencemag.org/content/sci/early/2014/11/05/science.aaa0114/F1.large.jpg

http://i.imgur.com/KKdHayp.png

K12b

26.45% North_European
19.54% Atlantic_Med
15.98% South_Asian
11.83% Gedrosia
6.59% Southeast_Asian
4.92% East_African
4.58% Southwest_Asian
4.39% Sub_Saharan
3.28% Siberian
2.00% Northwest_African
0.45% East_Asian
0.00% Caucasus

Davidski said...

No one cares which bullshit ADMIXTURE clusters show up in a 24,000 year old European.

Unknown said...


I disagree since it illustrates very well how Europeans were changing changed from upper paleolithic to late mesolithic.

Unknown said...


Facial snps suggest he looked similar to guys like Papuans who can look pseudo-caucasoid but are australoid ENA. He is totally out of European range of facial SNPs.
http://i.imgur.com/qeunXW0.png

NKent805 said...

You are right! But they have no problem with Reconstructing Ancient Native American Faces with European features like Kenniwick Man and Spirit Cave Man. Hypocrites!

NKent805 said...

Paranoid much?

Anonymous said...

Obviously generic white guy. Some features don't really exist outside europe. Not sure what else anyone would expect.

MrK said...

"Multivariate statistical methods and parallel studies of the buried skull structure and dentition established that their morphological characteristics undoubtedly belonged to the Caucasian complex."

That's putting the cart before the horse. Kostenki 14 predates the Caucasus Hunter Gatherers, Villabruna Complex Western Hunter Gatherers, Natufians, etc. by around 20,000 years.

And all of the above's dna is already in Kostenki14. Also, all the early and late Western Hunter Gatherers had the ancestral allele for skin pigmentation. They had no depigmentating peptide bond deletions on the genes SLC24A5 or SLC45A2.