Sunday, January 17, 2021
A tantalizing link
A new paper at PLoS ONE reports on the first human genomes reliably associated with the Single Grave culture (SGC). They were sequenced from remains in a burial at Gjerrild, Denmark, roughly dating to 2,500 BCE.
Surprisingly, one of the male genomes belongs to Y-haplogroup R1b-V1636, which is an exceedingly rare marker both in ancient and present-day populations.
However, the results do make sense, because the earliest instances of R1b-V1636 are in three Eneolithic males from burial sites on the Pontic-Caspian (PC) steppe in Eastern Europe, which is precisely where one would expect to find the paternal ancestors of the SGC population. The SGC, of course, is the westernmost variant of the Corded Ware culture (CWC), and there's very little doubt nowadays that the CWC had its roots on the PC steppe.
A Copper Age individual from Arslantepe in central Anatolia also belongs to R1b-V1636, which suggests that Northern Europe shared a very specific link with Anatolia via Eastern Europe during a period generally regarded to have been the time of early Indo-European dispersals.
Numerous SGC barrows or kurgans dot the landscape in what are now the Netherlands, northwestern Germany and Denmark. Unfortunately, most SGC human remains have been eaten up by the acidic soils that exist in this area.
Citation: Egfjord AF-H, Margaryan A, Fischer A, Sjögren K-G, Price TD, Johannsen NN, et al. (2021) Genomic Steppe ancestry in skeletons from the Neolithic Single Grave Culture in Denmark. PLoS ONE 16(1): e0244872. https://doi.org/10.1371/journal.pone.0244872
See also...
Maykop ancestry in Copper Age Arslantepe
Subscribe to:
Post Comments (Atom)
252 comments:
1 – 200 of 252 Newer› Newest»I am curious, how much ancestry did these SGC samples contribute to modern Scandinavians? Do modern Scandinavians have PWC admixture (I believe they have trace amounts)? I know at a minimum modern Nordic countries have significant additional celtic admixture, most prominent in Iceland/Norway.
It looks like these particular steppe lineages were not so successful because they were killed by war arrows:
the Gjerrild 6 skeleton had a flint arrowhead of the so-called D type embed-
ded in the breast bone. Arrowheads of this type are thought to belong to the later SGC (c.
2525–2250 cal BCE, [6]: 438–9) and this is confirmed by our radiocarbon date of the Gjerrild 6
skeleton (Table 1). The excavator of the monument suggested that Gjerrild 6 was the last per-
son to be buried in the grave but this is now contradicted by the 14C dates [22]. Type D arrow-
heads derive from the classical PWC tanged arrowheads (types A-C) as shown by
morphological similarities and hybrid (C-D) forms. However, their relationship is also
reflected in the eastern distribution of type D arrowheads, including a concentration of finds
on Djursland, which overlaps with the former PWC areas. Type D arrowheads are short (often
5–7 cm), three-sided, completely chipped points that appear technically poorer than type C,
which they derive from. Both type C (PWC) and type D (SGC) are probably to be regarded as
specialized war arrowheads, which is confirmed by the Gjerrild find [64, 65].
It is both interesting and frustrating that the first Single Grave R1b is R1b-V1636.
Battle Axe=R1a Z284
Single Grave=R1b L51
Fatyanovo=R1a Z94
Western Poland/Eastern Germany=R1a L664
There is a correlation between Corded Ware subcultures and Y DNA. But not a perfect correlation because R1b L51 is also in Polish Corded Ware.
Davidski, is anyone working on a comprehensive DNA study of Corded Ware yet?
Did the Arslantepe individual come via the Balkans or via the Caucasus ?
@ Romulus
Interesting. How did SGC come into direct contact with PWC if the Battle Ax Culture basically separated the two ?
Aside from the interesting lineage, is this megalithic grave context. Which is not a TRB or related megalith, but newly contructed in the post-3000 society. Apparently, East Danish Bøstrup cists have similarities to galley Graves in SW Swedish. Some have further advanced the idea that the original idea comes from true Megalithic graves in NW Europe (e.g. France, Belgium). If so, the extra MNE ancestry in these samples might correlate with that (if that's what they indeed, suggest they are 'less steppe'', the article is worded oddly)
The tree is confusing. Why did Arslantepe split earlier than the earliest Piedmont Sample ?
And it seems that Gerrilds Ancestors started separating from the Earliest Piedmont Sample between 6800 and 6000 years ago.
Also interesting is that the Khvalynsk Ancestors split after Arslantepe but before Early Piedmont...
There was probably a population rich in different R1b-V1636 lineages on the steppe, and some of these lineages left the steppe at different times.
So there's no way of knowing when the Arslantepe V1636 lineage arrived in Anatolia based on that phylogenetic diagram.
@ Davidski
Yes indeed. Looking at this few samples it seems that it came from a population outside but bordering the Piedmont and Khvalynsk territories. Maybe somewhere West of the Don...
Mr Eurogenes, i.e. "The Moron".
https://www.yfull.com/tree/R-V1636/
I have explained many times that the origin of R-V1636 is in Italy, i.e. in the "Italian refugium", because Italy gets all the 5 known haplotypes, whereas elsewhere there are only a few of them. Also from the YFull tree we see that also the oldest separated subclade (R-BY202076, present also in Italy from the known STRs) separated 6500 years ago is present in China (YF78902) and Iraq (YF73323) separated only 5000 years ago and derived from a sample migrated from Yamnaya to central Asia with the following back migrations, but the sister clade R-CTS6460 has got samples separated 6100 years ago and they are only in Italy and Western Europe. The other subclade, what I called the "Caucasian cluster", has got samples not old than 4000 years ago.
@Gioiello
You're banned so you can't comment here.
But I allowed this one comment to go through so that we can all laugh at you.
I think last year and this year will be great for the haplogroup obsessed people because the data that has come out has shown that the real situation is far more complicated than the simple R1a vs R1b maps people want to draw.
@ Gioiello
Very interesting. So basically most of the V1636 brothers stuck by each other all the way from the Steppe to Italy....Close family.
@ Ric Hern
"Interesting. How did SGC come into direct contact with PWC if the Battle Ax Culture basically separated the two ?"
PWC already spread to Jutland (3000 BCE) from Sweden before either the Jutland Single Grave Culture (2850 BCE) or the Swedish Battle Axe Culture (c. 2700 BCE) appeared. So plenty of opportunity for direct contact :)
It has absolutely nothing to do with SGC. Well what a burial Singles Graves? In this burial there is nothing from the CWC, there are no battle axes, only arrows, which is not a sign of the CWC (sign BBC), there is no characteristic pottery, it is collective, in megalithic, it is very late, and in general, as we know, the BB lived there at that very time.
See https://i.ibb.co/ysMC0zL/Centum-IEgroups.png
So this is not only an unreliable SGC, but at best another Pseudo-SGC, with equal probability it is the BBC.
It is possible that there was BB killed by SGC. This mixing zone BB and SG and conflict between them. The fact that one of them was killed by an SGC arrow speaks for the fact that this burial is not SGC, but is just the burial of their opponents.
" The fact that one of them was killed by an SGC arrow speaks for the fact that this burial is not SGC, but is just the burial of their opponents."
Because infighting between members of the big happy SGC family was surely unthinkable.
@ Slumbery
They would make sense if this burial contained at least some CWC signs, but they are not there, there are only signs opposite to it. All there is is one killed by an arrow attributed to SGC. This is too little, in this way anyone killed by a Roman soldier anywhere in Germany becomes a Roman because he is killed with a Roman weapon.
@Archi
Except Denmark was mostly SGC territory, not Bell Beaker. The Beakers only lived in certain areas, rather than dominating the whole territory. And SGC still lived there in that time period.
Once R1b-L51 appears in SGC, you will start saying they’re Bell Beakers as well, right? If R1a shows up there, you will claim they’re the only true SGC, even if they’re autosomally identical to R1b samples are obviously non-local, right?
@Gabriel
"Except Denmark was mostly SGC territory, not Bell Beaker."
This is not correct. It was on this territory that the BBC lived.
https://www.researchgate.net/figure/1-The-distribution-of-settlements-with-Bell-Beaker-ceramics-in-Denmark-from-Sarauw_fig1_315697829
BBC lived there in that time period.
And yet, do not trust those dates from this burial, this is a coastal burial, they ate a lot of fish, and this is a sea fish. High Marine Reservoir Effect is two to three times stronger than the ever-discussed Fresh Water Reservoir Effect, which everyone always thinks about when it comes to Eastern Europe, but everyone forgets about Denmark with its High Marine Reservoir Effect. They never appreciate it, it’s just ridiculous to write about the reservoir effect in steppe people, and to say that fishermen from coastal Marine Denmark had less of it. Even if we take their stated reservoir effect of 300 years, then all these samples belong to the interval 2250-2000 BC, as in the child Gjerrild 5 (one R1b), who probably ate the least fish since he is still younger.
By the way, in opposition to what the topic says that this sample Gjerrild 5 (R1b) is reliably SGC, in the table it is just marked as SGC/LN (2283-2035 BC), because strictly speaking it was just after SGC, during which they call LN, then there is a BBC.
@Archi,
Fair enough on the identification of the grave in time and space.
One major problem with your contention though, the poor son of a bitch is V1636. There's a reason why nearly all Iberians have been DF27, because they're all founder lineages. So basically every single R1b Beaker lineage has been L51 except maybe three in Hungary and Malpolska. The very first plausibly SGC is V1636!
To say that it is misidentified as Beaker is like...maybe a statistical stretch!
@Ric
PWC were fishermen who lived along the coast. CWC newcomers lived inland, and did not eat fish. Maybe they sailed their boats up and did a Viking style raid.
In Norse Myth, the Aesir did have hostility with the Jötunn.
Aesir - BAC
Vanir - SGC
Jötunn - PWC
My pet theory
What is also interesting is one of the Irish BA almost overlapping with one Battle Ax sample...
And by fish I mean seals
“ do not trust those dates from this burial, this is a coastal burial, they ate a lot of fish, ”
From the article - “ The results from Gjerrild 1 indicate a completely terrestrial diet, while values from Gjerrild 6, 7, and the loose mandible has a limited marine signal. A rough estimate suggests a possible marine reservoir effect for these three individuals at c. 45–60 years.. Gjerrild 5 and 8 represent children affected by lactation but should also have minimal reservoir effects (see discussion).”
“ their stated reservoir effect of 300 year”
Is the RE if someone at a wholly marine diet; which is not the case here
As for classification - I don’t think classical typology is good enough, new classes based on time & anthropologcla indicators are required, with very samples gone over with fine tooth comb
@Rob
I saw this text, they are absolutely erroneous, there can be no two opinions. I have already noticed many times that the Danes are deliberately mistaken as to the aging of their samples.
Compare
Corded Ware/Nordic MN Denmark Kyndelose, PMD 17, V, N chamber lower layer [RISE61] 2851-2492 calBCE (4071±27 BP, OxA-28296) R1a1a1b1a3b1 [Reported as R1a1a1] Page7+; [*Tagankin adds: CTS8401+ , Z281+]
R-CTS8401 Z659/CTS8401 formed 4200 ybp, TMRCA 4200 ybp info
R-Z281 Z679/CTS6350 * Z90/Y2399 * Z657/CTS4762+14 SNPs formed 4200 ybp, TMRCA 2600 ybp info
Their calculations for isotopes are simply always erroneous, for example, the Freshwater reservoir effect is practically always 0 for isotopes, it is too weak. They just noodles on the ears hang ignoring the High Marine Reservoir effect.
This is clearly indicated to them by archeology, which they are forced to deny because of their erroneous methodology. Archeology tells them that these people are buried in a late short period, but they are forced to stretch it for 500 years or more.
quote "This implies an earlier monument construction and a longer use period than the archaeological typology had indicated. The slightly younger date of individual 5 corresponds to the Late Neolithic in the chronology"
Interesting factoid about the PWC and by extension SHG: They were genetically cold stress adapted, whereas EEFs were not.
"The results of the present analysis firmly sug-
gest that the bearers ofthe Pitted Ware tradition
were adapted to cold stress, and that the
populations buried in South Scandinavian
collective graves were not. "
This is based on their nose shape, thin nose is good for cold air. That's a layman simplification.
https://www.google.com/url?sa=t&source=web&rct=j&url=https://journals.lub.lu.se/lar/article/download/21685/19524&ved=2ahUKEwjNi7K77qbuAhW9GFkFHSWWAQcQFjABegQIARAB&usg=AOvVaw2RPaaTclwMkNxSU9FuI-pz
Explains why when the climate got colder 5000 years ago GAC went south east and FBC disappeared. Then CWC showed up and tried it again, which met the same fate when the age of Germanic migrations began. History repeats.
I watched a documentary the other day on Cimbri bog bodies and it showed those Danes starved every winter, by looking at skeletal density during growth periods.
Scandinavians have a lot of Corded Ware ancestry, so no, history doesn't always repeat.
Also, apart from the Corded Ware R1a-Z284 in modern Scandinavia, there's also R1b-U106, which is likely to be a Corded Ware marker too.
My meaning was that in the past, poor conditions in Scandinavia have prompted mass migrations out of Scandinavia. Which is true. But you are right about CWC being the foundational ancestor of modern Scandinavians
That said, the centuries of Germanic migrations must have caused some loss of diversity there. As well celtic slaves and finno ugric invaders. The Viking and Iceland DNA is a perfect match for modern Scandinavia but the older groups like the Lombards, Goths, etc. have some unique elements.
@ Romulus
I can not imagine people from the Steppe being less cold stress adapted. Does it not get colder the further East you move ?
@ Romulus
Okay, I can see that Sweden experienced some extremely low temperatures but Denmark not much more than Poland, Russia and Ukraine...
@Ric
Well the paper is clear EEF wasn't cold adapted , I don't believe CHG would have any reason to be, but EHG probably was. Given the composition of CWC/Steppe people I would assume no.
Could be the cold stress adaptation happened during the Ice Age in Europe and not in situ in Scandinavia.
@Romulus,
Your theories are interesting.
As far as I know, Scandinavia has excess hunter gatherer ancestry but it is WHG not SHG/PWC.
SHG including PWC basically died out. Except Saami probably have some or they have EHG.
@Genos
I have the same y chromosomal haplogroup as 3 PWC HGs and one Narva HG. I2a CTS595+ (PWC) L233+ (Narva), there are about 800-1000 of us on FTDNA. Almost all Brits with Norman surnames, but also many Swedes and Germans. There is one unique pre L233 branch found only in Normandy as well.
Very rare but also far from extinct. The n=100,000+ UK biobank estimates L233+ at 0.5% of British males. There could be as many as 100,000 of us.
Hence why I am read up on obscure PWC/Narva papers and why I am certain they did not go extinct.
Spiginas1 could be assigned as I2a1a2a1a based on L233:G→A (2x). This individual
also has one upstream mutations for haplogroup I2a1a2a (L1286: G→A at 1x) and
one mutation for I2a1 (PF4004: T→C at 1x) and I2a (L460: A→C at 1x).
There is a paper focused just on L233+ because we have a unique mutation on our Y chromosome called the ePAR, extended pseudoautosomal region.
https://www.google.com/url?sa=t&source=web&rct=j&url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6193736/&ved=2ahUKEwiP1ez_l6nuAhXdFzQIHbPRBPoQFjAAegQIBBAB&usg=AOvVaw1O8O8m6xbwOG2Y7JbPwZbX
And if you want to know what a PWC or Narva paternal descendant looked like, we have a famous one:
https://en.m.wikipedia.org/wiki/John_Benbow
Romulus, very cool you belong I2a1a2a1a. I had no idea till now. I didn't know I2a1a2a existed, I only saw it in ancient DNA results. So you come from one of the few I2a guys who survived the R1b and R1a onsalught. Congrats.
I'm thinking through the ancient DNA.
No Neolithic farmer I2a clans have found with I2a1a2a. That source can be excluded I guess.
But there are several I2a1a2a in European hunter gatherers: Bichon Switzerland 13ky, KO1 Hungary 13ky, Motala 8ky, K01 Hungary 7ky, Narva, PWC.
So I mean its relatives were widespread before Neolithic. But are PWC and Narva the only confirmed I2a1a2a1-L233? That would make them a big candidate as the source for modern L233.
Corded Ware Switzeland I think belonged to some kind of I2a1a2a1. But I can't find source. It was people here who tested its Y DNA. Maybe it is direct ancestor of your L233.
@ Romulus
Which PWC ID # ?
'' I2a1a2a1. But I can't find sour'
Furtwangler https://www.nature.com/articles/s41467-020-15560-x
@Genos
Narva is the only one that is L233+, all the PWC are CTS595 which is also upstream of Sardinian M26. Given how uncommon it is that may well be the origin spot. I think the most sensible explanation for its survival is that it lived on because it came from a very remote group which never admixed with farmers and lived on in the margins of Scandinavia until it was finally assimilated. PWC survived on the Island of Gotland quite late. But the are also Narva remains from very late ,1750 BC.
@Rob
vbj013
Ajv70
AJV58
Motala 9, KO1, and Bichon are upstream of CTS595 but positive for +L1287.
There are 2 CTS595+ from neolithic Ireland but they are Iberian Neolithic Autosomally and most likely along the modern Sardinian branch.
Sorry 1287 is downstream of CTS595
@Rob
All those Swiss Neolithic samples are terminal SNP M423 , their code is I2a1a2 but the codes for I2 got all messed up in ISOGG 2019. They are on the Balkan I2 branch.
https://www.yfull.com/tree/I-Y4192/
They have Bichon on there, apparently its ancestral for 1287 but along that branch.
@ Genos
“So you come from one of the few I2a guys who survived the R1b and R1a onsalught.””
That’s quite a simplistic, but commonly encountered view. East of the rhine, there was quite a lot of I2a around after CwC, you should be aware of the aDNA data (eg Swiss, Tollensee; Unetice, Hungary). It’ll only accumulate . Truly, in BB territory, I2a, G2a etc seem to have virtually disappeared
Current patterns are largely dictated by more recent event, especially the attrition of ancient Celtic/ Germani from Central Europe, with subsequent expansion of R1a-rich Slavs & R1b-P312 rich Ottonian-Germans from the Rhine in the Middle Ages
The carpathian basin was particularly volatile. Every 3-400 years there was cultural shifts
@ Romulus
Yes I’m not a fan of the new coding in ISOGG 2019/20
How much did the Black Death affect the different Y-DNA groups ?
And what about the Great Famine just before the Black Death ?
@ Ric
The Y chromosome does not correlate with immunological function (but it does code for certain reproductive-associated genes, e,g. sperm motility, etc), but of course, if certain key regions were impacted then repopulated, this would have made impacts in loco-regional spatial-frequency patterns in Y-DNA. But ultimately we do not know, because we would need aDNA from pre- and post-Black Death..
"Ric Hern said...
And what about the Great Famine just before the Black Death ?"
I recall reading there is evidence of disease based selection in haplogroup I, (i.e. Different HIV progression & 50% increased risk of heart attack) and if this is generally true for other haplogroup, then it may be the most important driver of current haplogroup frequencies. But we don’t know for sure yet.
@Rob
"R1b-P312 rich Ottonian-Germans from the Rhine in the Middle Ages"
What makes you think that R1b-P312-rich Germans from the Rhine expanded during the Ottonian regency? I can't see any reason for such an assumption. If there was a post-Celtic expansion of R1b-P312 towards east of the Rhine, I'd rather link it with the Frankish empire of the Merovingians and Carolingians. Movements of people from the Frankish heartland in Belgium and Northern France into subdued areas are archaeologically attested. These were not mass migrations though, the demographic impact was limited. But the Franks also subdued the last pagan Germanics of the continent with brutal methods like massacres, deportations and forced conversions, thereby destroying the Germanic character of their cultures and transforming them into something Roman-Christian and Medieval. Only few centuries later, rhe by these means transformed ones went on to apply the same rigorous methods to the remaining pagans in the east...
@ Simon_W
its pretty obvious that there have been significant changes in 'Germania'. Modern Germans plot distinctly to ancient Germani. I say ''Ottonian'' because the main resettelement began from the 9th cenutry onwards, during the history of East Francia, later the German Empire ("HRE").
The depopulation began ~ 400 AD, and continued with the Carolingian expansion. Concurrently, the regione became Slavicised as far as Thuringia and northern Franconia. As above, the main settlement by Germans occurred later into Slavic lands.
@ Rob @ Garvan
Yes indeed. We do not know. So attributing the demise of certain Haplogroups to R1b or R1a expansion only is speculation at best since Europe went through many natural disasters throughout history.
@Rob
Sure, modern Germans don't plot like the ancient Baiuvari (DEU_MA), except perhaps the most northern and northwestern ones - I don't call that into question. And I see, you were merely referring to the eastwards movement into depopulated and Slavicised lands. In this sense you're right with putting the beginning of this process roughly into the 8th/9th century.
However, this doesn't explain the south-/westward shift in Germanic areas to the west of this, areas that were firmly Germanic in 700 AD. There were recently some discussions with Genos Historia aka Samuel Andrews about the possible reasons. He argued that it was because of Romanized Frankish admixture in the Merovingian era, while I tended to argue for some continuity of the Gallo-Romance population even after the fall of the western Roman empire.
I guess both factors had some effect, the question is rather, which one had the bigger effect.
In any case, after the fall of the Roman empire and the migration era/Völkerwanderung, there were still pockets of Gallo-Roman speech east of the Germanic/Romance language border. Most of all, there were three large Romance pockets: One around Salzburg, the "Salzburger Romania" that persisted into the 11th century. Then the "Moselromania" around Trier that dissolved around the 10th-12th century, see: https://de.wikipedia.org/wiki/Moselromanische_Sprache
And then Raetia Curiensis, that was still a large Romance area deep in the Middle Ages, and where Romansh has survived to the present day, though only in a few parts.
In addition to this there were several smaller pockets of Romance speech: one in the central Black Forest, one in the Eifel around Prüm and Mayen, one around Saint-Avold in Lorraine (that's in present-day France, though), several ones in the Hunsrück and in the southern foothills of the Hunsrück, and one between Koblenz and Bingen on the Middle Rhine. These were probably assimilated by the 8th/9th century, though their end is difficult to date, due to the scarcity of sources. I strongly suppose that these pockets were also genetically different, more Gallo-Roman and southern, and that after their assimilation the Gallo-Roman DNA ancestry slowly and gradually dissolved into the neighbouring areas, a process not linked to any particular regency or politics.
Citation:
Hubert Fehr, Germanen und Romanen im Merowingerreich, p. 77-78.
@Garvan
There is correlation between y hg I1 and heart disease but not other hg I branches. It's specific to I1. I read a paper that hypothesised it was related to testosterone since steriod users often die of heart attacks/ heart disease but they found no difference between y haplogroups and testosterone levels, the study was done on Poles so it looked at differences between R1a, R1b, I1. I can't really remeber which hgs tbh.
Higher testosterone levels would confer higher immune function , but its a trait like height which is foremost determined by environment.
I believe throughout history, genocides and plagues would have massively disporportionately affected urban populations.
Maybe I am wrong about I1 but here is that paper
https://www.researchgate.net/publication/260011870_Coronary_artery_disease_predisposing_haplogroup_I_of_the_Y_chromosome_aggression_and_sex_steroids_-_Genetic_association_analysis
@Romulus
"Higher testosterone levels would confer higher immune function"
To the contrary, the opposite seems to be true:
https://theconversation.com/coronavirus-does-testosterone-really-make-infectious-diseases-worse-in-men-135158
https://med.stanford.edu/news/all-news/2013/12/in-men-high-testosterone-can-mean-weakened-immune-response-study-finds.html
@Simon
Respeftfully, I don't believe it and I think the basis of those studies is flawed. To be able to make that conclusion they would need much more and better data. Horomone levels (provided they aren't artificial) correlate with health throughout life in men and women.
Who would have a stronger antibody response to coronavirus as measured by their blood, someone with no symptoms, or someone who almost died? I would bet men's testosterone levels directly correlate with severity of infection.
I don't think there is any clear or direct correlation beteween Y-DNA, testosterone & immunity. But there is a form of inverse correlation. If somebody has chronic illness, espeically a male child or adolescent, then the body preferentialises cirticosteroid production over sex-steroids, in the adrenal cortex, both of which the substrate is cholesterol. This can in turn leave lasting phenotypic manifestations if an indolent & ongoing process. The theory is, this is why women have preferred manly -looking men. Size, squared features and a bit of attitude are phenotypes of testosterone, meaning the man has had a healthy childhood (without 'switching off' T), and therefor doest not have any major genetic disease to pass on to offspring.
@ SimonW
Yes all three factors must have been important, incl pockets of Romansch speakers. I think there is good archaeological evidence for this for Inntal, Salzburg and parts of Switzerland (w.g. continuity of Churches, Christian relics, etc). It has also been overemphasies in the past (e.g. -wahl toponyms, usually being later - 11th century foundations - rather than actually 'Roman' survivors. I pointed this out to FrankN in the past).
Also the Franks, by the time of their expansion, must have been Gallicised, as their identity had galvanised around an anti-Syagrius faction of the Loire field army
@ Romulus
Do you have any views about I2a-M423 -L621 ?
@Rob,
Sure, sure....I2a thrived in many places in Central Europe after Corded Ware.
But, we'll see exactly what was happening with a thorough sampling of Bronze-Iron age East/Central Europe. To see how much R1a, R1b, I2a there was.
Maybe I2a-Din in South Slavs isn't a strange coincidence as we tend to view but comes from among several I2a lines which thrived in East-Central Europe.
Romulus's I2a1a2a1 is West European, which makes it one of few i2a survivors in West Europe.
Looks like the Fatyanovo paper was published:
https://advances.sciencemag.org/content/7/4/eabd6535
@Davidski
Do you know anything about the sample from Karelia with R1a2-z93, it's from some russian work about Mongol invasion's victims in old Yaroslavl. They refer him or as Yamnaya culture individual? or as a H&G? but since there was no Yamnaya culture in Karelia, he was rather a H&G. Interesting haplogroups of the victims from the 13th century. Out of 30 individuals Y-DNA individuals: R1a - 18, R1b - 3, I1 - 2, N3 - 2, J2b - 1, J1c - 1, I2a - 1, G2a - 1, E1b - 1; mt-DNA, out of 19 individuals: U (U4, U5a, U5b) - 10 (among them U5a - 5), H - 4, K - 2, V - 1, X - 1, J - 1
I don't know anything about those samples, but it's very unlikely that any Karelian hunter-gatherers belonged to R1a-Z93.
@Draft Dozen
"Do you know anything about the sample from Karelia with R1a2-z93, it's from some russian work about Mongol invasion's victims in old Yaroslavl."
There is no such publication. This is someone just misspoke.
New dataset:
*** V44.3: New data release: Jan 20 2021 ***
https://reich.hms.harvard.edu/downloadable-genotypes-worlds-published-ancient-dna-data
5740 I6222 I6222 3320-2918 calBCE (4415±31 BP, OxA-36222) Mongolia_Chalcolithic_Afanasievo_1_contam R1b1a1b1a1 25 R .. .. [0.815,0.861] 0.042 .. 22 n/a (<200 SNPs) n/a (<200 SNPs) n/a (<200 SNPs) -0.039 0.056 Model_Misspecified [0,0.071] ds.half S6222.E1.L1 QUESTIONABLE_CRITICAL (damage.ds.half=0.042, mtcontam=[0.815,0.861])
@ Archi
5976 I6561 I6561 Mos70, Skeleton 5, 88 knees up tooth 2018 MathiesonNature2018 Pinhasi, Ron Context: Layer date based on 6 20-28 cM IBD individuals with Srubnaya/Alakul/Kazakhstan_MLBA individuals from 3900-3400 [based on these genetic results we ignore the direct date of 4153-3970 calBCE (5215±20 BP, PSUAMS-2832) from same site calibrated as 95.4%; IntCal20, OxCal v4.4.2 Bronk Ramsey (2020); r:5; Atmospheric data from Reimer et al (2020)] 5600 144 3900-3400 BCE Ukraine_MBA Alexandria Ukraine 49.54067778 37.69799444 1240K 1 1.422231 738261 .. M n/a (no relatives detected) R1a1a1 438 H2a1a .. .. [0.997,1.000] 0.028 0.421 2374 0.003413 2.311805925 [0.001,0.006] 0 0.015 None [0,0.029] ds.half S6561.E1.L1 QUESTIONABLE (damage.ds.half=0.028)
@Davidski
@Archi
As I understand, this is from an unpublished work, from some presentation, page 18
https://m.vk.com/doc1206286_581896259?hash=eac25fe32159f1168c&dl=44158598e0170621d6
@Arza
What are the new samples in this new release?
And if there are new samples in it, can you make a PLINK file with them and send it to me?
I'm still going trough the diff file. New ones are mostly recently published samples from other labs, South America, some new HGDP in 1240k. The new ones from "A Minimally Destructive..." are not there. Nothing spectacular in general.
I'll try to make a dataset with all the new samples, but the update of G25 won't be easy. Almost all samples are renamed and there is a lot of them now marked as contaminated.
@Rob
No I am not knowledgable about that clade.
@ Davidski
Diff:
https://pastebin.com/NCfp77yh
@Arza
I marked the PSU AMS date for Alexandria I6561 as wrong a long time ago, a new radiocarbon date is needed for this sample from another laboratory. "IBD individuals with Srubnaya/Alakul/Kazakhstan_MLBA" is a very correct remark, Ukraine_MBA is a good mark, but I adhere that Abashevo and Sintashta are MLBA, and Srubnaya/Alakul/Andronovo is LBA.
Now this sample should be called simply Alexandria1 and nothing else.
"6 20-28 cM IBD individuals with Srubnaya/Alakul/Kazakhstan_MLBA"
Distance to: UKR_Alexandria1:I6561
0.01814552 RUS_Potapovka_MLBA:I0419
0.01911596 RUS_Sintashta_MLBA:I1086
0.02050415 RUS_Sintashta_MLBA:I1082
0.02143992 RUS_Sintashta_MLBA:I1064
0.02236940 RUS_Sintashta_MLBA:I1029
0.02252443 RUS_Sintashta_MLBA:I0939
0.02394828 RUS_Sintashta_MLBA:I1027
0.02400750 RUS_Srubnaya_MLBA:I0234
0.02405639 RUS_Poltavka_o:I0432
0.02434173 RUS_Sintashta_MLBA:I1088
0.02453385 RUS_Sintashta_MLBA:I1084
0.02466921 RUS_Srubnaya_MLBA:I0232
0.02750236 RUS_Petrovka_MLBA:I0945
0.03675119 Yamnaya_UKR_Ozera_o:I1917
0.03773659 RUS_Sintashta_MLBA_o2:I1020
0.03796235 RUS_Poltavka:I0371
0.04042178 Yamnaya_RUS_Samara:I0357
0.04241710 Yamnaya_RUS_Kalmykia:RISE240
0.04290886 RUS_Poltavka:I0126
0.04363760 Yamnaya_RUS_Samara:I0439
0.04374803 Yamnaya_BGR:Bul4
0.05189827 Yamnaya_RUS_Caucasus:RK1007
0.05231482 RUS_Steppe_Maykop_o:SA6013
0.05357201 Yamnaya_RUS_Samara:I0438
0.05373276 RUS_Sintashta_MLBA_o2:I0983
0.05489909 Yamnaya_RUS_Caucasus:SA6010
0.05529873 Yamnaya_RUS_Samara:I0429
0.05672495 Yamnaya_RUS_Kalmykia:RISE546
0.05733132 RUS_Khvalynsk_En:I0434
0.06026782 RUS_Srubnaya_MLBA_o:I0354
0.06057854 RUS_Potapovka_MLBA_o:I0244
0.06316882 RUS_Steppe_Maykop:SA6004
0.07193740 RUS_Sintashta_MLBA_o3:I1028
0.07255846 RUS_Sintashta_MLBA_o1:I1017
0.07258857 RUS_Sidelkino_HG:Sidelkino
0.08385887 RUS_Sosnoviy_HG:I5766
0.08915806 RUS_Karelia_HG:I0211
0.09180615 UKR_Trypillia:I2110
0.09222229 UKR_Globular_Amphora:ILK002
0.09247513 RUS_Sintashta_MLBA_o1:I1007
Target: UKR_Alexandria1:I6561
Distance: 1.1853% / 0.01185341
63.6 RUS_Sintashta_MLBA
12.6 RUS_Petrovka_MLBA
10.2 RUS_Srubnaya_MLBA_o
6.2 UKR_Globular_Amphora
4.6 Yamnaya_RUS_Kalmykia
2.8 Yamnaya_UKR_Ozera_o
@Draft Dozen This sentence about Yamnaya sample in Karelia is most certainly a mistake. The author of the presentation is a geneticist, not an archeolog.
The sentence is "Древний образец из Ямной культуры (охотник-собиратель из Карелии) относится к подгруппе R1a2-Z93."
Translation is "An ancient specimen from the Yamnaya culture (hunter-gatherer from Karelia) belongs to the R1a2-Z93 subgroup."
There are several inconsistencies in it. First, Yamnaya is Copper-Bronze age culture, not hunter-gatherers. Second, Yamnaya was never present in Karelia. So it's 99.99% mistake. Most likely author somehow confused information abour EHG component in Yamnaya and EHG sample from Karelia.
Testosterone certainly suppresses the immune system. I feel that higher androgen levels may have evolved in those with stronger immune systems. Too much androgen and too weak an immune system would be a bad combination.
@Arza
Do I understand correctly that the questionable part is the dating?
Off topic: Had a look throuh new anno file updated yesterday by Reich group. Lots of dates and data updated. Cool as I can look at how patterns of distance on G25 to groups like Han Chinese change over time. (Quick visualization of the dated transect in East Asia, excluding very Northern and Southern groups, on G25: https://imgur.com/a/yqXe1WB).
One sample I noticed did have a very wide dating was the sample: I10899 which is called Iberia_Southeast_Meso in Global25 but which the anno file gives a very wide dating of 40000-5000 BCE, with a median of 24450 YBP. Median date is much older than El Miron and comparable to MA1.
So perhaps this sample is not really representative of a Mesolithic and distinct population in Southeast Iberia with high levels of GoyetQ116 ancestry at all, and is just an old sample! The population in Iberia may have transformed to the Iberia_Northeast_UP_Azilian type Villabruna ancestry long since...
@All
I'll need some help with this.
Someone please take this Global25 datasheet and correct the labels that are clearly wrong.
https://drive.google.com/open?id=1YKkEOtyV5SISvmY_FyS4YSLXCxxYt5_W
Also, please add the "contam" suffix to the samples that have it in the new anno file.
There’s an section committed to the issue of dating I10899 in Olalde 2019. Several C14 attempts failed
They argue “ Based on these lines of evidence (% Neanderthal admixture, mtDNA U5b1, etc,) we conclude that the Car1 individual likely lived during the Mesolithic period, 9700–5500 BCE. We caution, however, that a direct radiocarbon
date would provide the most accurate estimat”
@Davidski
Polish CWC, French IA, Ireland and some medieval German samples published in 2018:
https://drive.google.com/file/d/1JjZa-HaBM9vNB9SFGsmr4j9xxVgduEAc/view?usp=sharing
I can send you anything you want, but I need to know what exactly. Vikings? Swiss LNBA?
I need the samples that aren't in the G25 yet.
The Swiss samples are already in there, as far as I know.
Are there more of the French samples? How about that Bell Beaker with a lot of steppe ancestry?
OK, that Bell Beaker is CBV95, and you sent him through already.
@ Davidski
Some of the French data from rivollat or Brunel is missing
@Davidski
I thought that you'll be updating them to Reich's version.
"_contam"s added:
https://drive.google.com/file/d/1tx2_ZVsuD1fawaP5B5AJ4h6gyrfbkYwb/view?usp=sharing
Luckily most of contaminated samples are not in G25.
@ epoch
Do I understand correctly that the questionable part is the dating?
It's questionable due to the damage patterns it shows. Wrong dating is another thing.
Analyzing modern day population phenotypes after thousands of years might be somewhat misleading because of drift/founder effect/selection, etc... but these Fatyonovo samples are fairly ancient and have "slight EEF" with about 1/3rd light hair/eyes. We also know from Morocco samples that were 50% EEF, that they had light features (skin/eyes).
Yamnaya generally had darker features and so did EHG except for lighter skin, but in Corded Ware-related samples we start to see blue eyes/blond hair pop up.
Is this through EEF? I know this largely doesn't match with modern day populations, but what other explanation is there for these ancient samples.
@DragonHermit,
"Is this through EEF? I know this largely doesn't match with modern day populations, but what other explanation is there for these ancient samples."
It's really strange since a high rate of pale skin, blond hair and blue eyes correlates with high Steppe ancestry. Even Non-Europeans, such as Central Asians, Pushtuns, Tajiks, Hazara or Kalash people display sometimes light hair, pale skin and blue/Green eyes. All these groups have Steppe/Aryan admixture. Sardinians for instance, who are the closest population to EEF have compared to other Italians low percentage of light colored eyes. The percentage of light eyes in Sardinia is 13.9%, in Sicily 23.7% and in Calabria 19.6%. In contrast to that, Mainland Italy has in the North 40% and around 30% light eyes in the South. Besides, among Scandinavians the percentage of blue/gray/green eyes is 95%- 97%, so nearly 100%. Norwegians have the highest Steppe admixture of all Europeans.
@Wise-Dragon
Is it Steppe admixture though? That peaks at 50-55% and some of these features are close to 100% like you mentioned. And let's remember. These modern populations you mention are NOT direct Yamnaya-descendants (who are 100% steppe), but CW-like/Beaker people. Yamnaya only potentially affected some Balkan/Caucaus IEs. These are largely descendants of CW/BB populations which displayed these phenotypes.
And we do not see these features in people of Steppe ancestry until EEF starts mixing with them. I'd say farming diet + lack of sunlight over thousands of years contributed, but these features were present in high numbers even in antiquity as shown in this Fatyanovo study. If I'm not mistaken these samples are ~1/3rd EEF, and about ~1/3rd display those features. There's a missing piece of the puzzle here.
Re; blue eyes and patterns, well, thing is that ancestry diffs is correlated with environment, which may be correlated with selection, which can make inference of ancient phenotypes from moderns and their ancestral populationd difficult and potentially misleading.
I know that when I most recently tried to use even very complete modern data on heights (all populations of Europe today, all heights of populations today) to infer ancient "genetic height", there was some degree to which the shorter and taller ancestors out of WHG, steppe, EEF, jumped about a bit depending on the sample subsets emphasized in some different runs of regression. As some EEF richer populations (Belgium vs Ireland, Dinaric Alps Vs Central Europe) came out taller, so it tried to solve this in complex ways (sometimes dumped "shortness" into EEF, others WHG or Yamnaya). (Most runs placed shortness in EEF, but also underpredicted height in Dinaric Alps, Dutch, Belgian, Greek etc and overpredicted height in most steppe rich pops). I mention only as height also one of these traits argued to be correlated with ancient ancestry, where we have lots of data. Though height more sensitive to environmental upbringing.
So it is probably best to type ancient traits through genetics directly, where we can.
@Genos Historia
AFAIK there are some Normans who cluster further north, closer to England or between South Germans and England, but of course most Northern French would be like or south of South Germans.
@DragonHermit
We know that selection for features like light hair/eyes took place during the Bronze Age. Going by admixture proportions of ancient populations might not be the best way to look at things. If we look at things strictly by correlation we see that WHG admixture correlates with fair features. Finns, Balts and Scandinavians are the Europeans with the most WHG admixture and also the ones with the most blond hair and blue eyes. This doesn't mean that WHG looked like that, which is why it's better to look at fair features as something that became common as a result of selection when Europeans were already a mix of WHG, EEF and steppe. We already know from ancient samples that the genes were present in all 3 of those ancient populations, all that was needed was selection.
I used to say Blonde hair comes from Funnel Beaker/GAC, till new GAC samples came out all Black hair and Brown hair. Confirming they were typical Neolithic farmers. But I would like to see more samples.
I was being too open minded. There's no way a trait most common in former Corded Ware territory comes from Neolithic farmers.
@Wise Dragon
Yes, it is most likely through EEF, particularly through GAC and TRB. Dagestanis for example are the most Steppe admixed Caucasians, with 40% average Yamnaya/Catacomb ancestry, some can reach even 50% (https://i.imgur.com/lPX9E6S.png). They're also by far the swarthiest North Caucasians and among the swarthiest Caucasians as a whole.
You might think their native Caucasian (in their case Kura-Araxes) is the source of their swarthiness, but as per Wang et al, Kura-Araxans exhibited a higher prevalence of blue eyes and were about as light skinned as Yamnaya, see https://i.imgur.com/J7gyOkk.png (the so dubbed North Caucasus and Late North Caucasus in the bottom graph is Catacomb).
As for Pashtuns, Tajiks, Kalash etc, these people have GAC ancestry from their Sintashta/Andronovo ancestors. Scandinavians also have GAC/TRB/related.
Blonde hair comes from Corded Ware. Or I should say it was selected for and became common in Corded Ware and its descendants. Corded Ware created the difference between North and South Europe, so it makes sense it is also where blonde hair became a thing.
I looked at Fatyanovo allele frequencies. They have more derived light pigemented alleles than Yamnaya and Neolithic farmers. So they show signs of the selection beginning.
rs16891982 G%
Neolithic LBK-31%
Yamnaya-43%
Fatyanovo-62%
Bell beaker-64%
Unetice-87%
Sintashta-88% (according to Razib Khan)
Andronovo samples in old tests always came came out with blue eyes and derived in rs16891982. We'll see, maybe light features became popular overtime in Fatyanovo-Sintashta just as it did in Northern Europe. Making Andronovo more fair than Fatyanovo. But that sounds far fetched.
Following might (or might not) be useful for trying to identify which samples in new anno are present and under updated details.
When I tried to match sample IDs from my latest Global25 ancients datasheet to the anno file, I kept a note of which were present under the same ID (in either column 2 or 3 of the anno), which were present but under a variable sample ID, and which were present in my G25 datasheet but not present in the anno file at all.
That's here: https://pastebin.com/R6u8vrDc
Download and open as .CSV. The majority are under exactly the same sample ID.
Also included the dates, so if anyone wants to do some date analysis, you should be able to lookup the unique sample IDs generally to match to your datasheets.
I didn't generally take a note of the differing sample ID, unfortunately. Most of the time this was standard, like many samples are present with .SG (shotgun) or .DG in the ID, or in the case of the Italy and Furtwangler (Switzerland) study there are generally systematic differences to the IDs, like they drop a "_" from the ID, or "R" is used instead of "RMPR" (for Italy). But you can work this out by crosschecking for the date YBP and region.
My group IDs will probably differ slightly from the official G25 ones, as I just merge in new samples everytime a new Ancients datasheet comes out, and keep the old without changing Group IDs, and I've manually annotated some outliers. (So this means I stil have Yamnaya_RUS_Samara in datasheet or Anatolia_Boncuklu_N in my groups, rather than RUS_Yamnaya_Samara or TUR_Boncuklu_N or whatever). Plus my last update was from late December.
But it may be useful to see what I found from G25 datasheet was present and what was not(under same ID, different ID, not at all).
@rozenblatt
I see. So, Karelian R1a-z93 is also mistake.
@DragonHermit
"Is this through EEF? I know this largely doesn't match with modern day populations"
With ancient also. Look at EEF-like ancient Cretans. Did they look fair?
http://maritimehistorypodcast.com/wp-content/uploads/2015/06/im_12241_screen.jpg?x27115
http://maritimehistorypodcast.com/wp-content/uploads/2015/06/Ship_procession_fresco_part_4_Akrotiri_Greece.jpg?x27115
https://yeahwrite.me/wp-content/uploads/2015/12/Ship_procession_fresco_part_1_Akrotiri_Greece.jpg
"but what other explanation is there for these ancient samples"
An unintentional and unperceived or deliberate untruthful interpretation of the genes responsible for pigmentation.
@Wise dragon
"Mainland Italy has in the North 40% and around 30% light eyes in the South"
Doubtful. According to Paolo Mantegazza the Italy as whole light eye - 14%, Sicily - 2%, Venice dictrict - 28%.
@CrM
I can imagine that some selection related to lactase persistence in Funnelbeaker and GAC triggered selection for fair features. Maybe traits like that were selected for in Corded Ware who of course had a lot of ancestry from the dairy farmers of TRB and GAC. This study had 2 possible suggestions for why there was blond hair+blue eyes in EEF from central Europe.
"In the early farmers of Central Europe light eye and hair color both occurred; interestingly only in the same individuals. It can be argued if these phenotypes in the early farmers were introduced by admixture with contemporary hunter-gatherers during the migration towards Central Europe [Lipson et al., 2017] or if they are the result of population stratification".
https://d-nb.info/1209245647/34
Maybe several factors plays in here. Ancestry from the local hunter-gatherers along with selection could possibly explain their light hair and eyes?
@Genos Historia
I remember slightly higher rates for the derived allele of slc45a2 with Yamnaya samples from Wilde et al. I believe? Like 60% or so? Their catacomb samples were quite a bit lower less than 40% which given their genetic relation is a bit stra
Which datasets/sources did you use to get to 43%?
"Making Andronovo more fair than Fatyanovo. But that sounds far fetched."
Why far-fetched? Makes quite a bit of sense actually, although I doubt the difference would be massive.
@DragonHermit,
the Minoans were 85% EEF, 15% CHG and 0% Steppe. They were swarthy with black or dark brown hair and dark eyes.
The question of blondiness demonstrates once again the fallacy of "modern distribution analysis".
As for the EEF being darker that means nothing. The blue eyes and blonde hair originated in good number likely among TRBC and GAC women and later on was reinforced trough exogamy with incoming steppe pastoralists.
Ironically enough the "aryan race look" originated among the conquered women not the conquering man.
Modern distribution is meaningless. R1b L51 peaks up in atlantic europe but it origineted in eastern europe.
@Draft,
@Wise dragon
"Doubtful. According to Paolo Mantegazza the Italy as whole light eye - 14%, Sicily - 2%, Venice dictrict - 28%."
Nah. I have been to Italy myself from the North to the South. The locals, native in Northern Italy, especially Veneto/Friuli had often light eyes. Keep in mind, that today plenty Southern Italians live in North Italy, too. Anyway, the study which estimated that 40% of Northern Italians have light eyes, is realistic. From my own observation, light eyes among Italians is much more common than people think. Hence, 14% light eyes for Italy are way too low.
@Heyerdahl
The process must have been complex with selection and other factors at play. Sometimes pigmention just doesn't make sense if we're to go by the already-established consensuses.
You had light skinned, blonde, blue eyed SHG, a population that was predominantly WHG. You had EHG that were both blonde and blue eyed and both dark haired and dark eyed.
But the farmers are perhaps the most peculiar group of them all, far as pigmentation goes. It seems like GAC/TRB were the first predominantly blonde and blue haired farmer population (which kind of goes against the narrative that blonde hair is derived from ANE, considering that, far as I know, neither GAC nor TRB really had non noise-level of ANE admixture). There's also this case with Anatolia Boncuklu Aceramic who seemed to exhibit a high prevalence of blue eyes and even blonde hair, although I'm not quite sure how accurate the predictions are. See https://i.imgur.com/l85VZUP.png
I think most early farmers were Med-like in their complexion, but they could have selected for a lighter complexion as time went on, depending on the group in question.
@Draft Dozen
Mainland South Italy has between 23% - 28% light eyes, aside from Calabria that has only 19,6% light eyes. Light eyes are 30% in Central Italy.
@CrM
Yeah, the process was no doubt complex with many factors involved. Some of the most important to take into account are in my opinion
- This study https://d-nb.info/1209245647/34 notes that Mesolithic populations had a much greater in-group variation in phenotypes (notice the +- difference in WHG and EHG skin colour versus modern European variation for example).
- Lifestyles differed greatly between autosomally identical groups of people. Some EEF went to live in central and northern Europe and likely developed and selected for lactase persistence that way. The LP allele was found in a middle Neolithic individual from Sweden (Malmström 2010) that incidentally also had light hair and eyes, but LP was definitely not present in or fully selected for in all of TRB as it was a long and ongoing process. This could possibly explain the rather significant difference in pigmentation between different groups of EEF, but HG admixture is likely also an important factor there. The same differences in pigmentation between HG groups likely existed.
- A possible underrated factor could be WHG from central Europe or other groups similar to them if we're to go by Blöcher 2020. They displayed an increased frequency in alleles associated with light hair and light eyes. The farmers with presumed admixture from them also had that increased frequency. Coincidence or not, we don't know yet.
About the Anatolian samples you mention. We know from this study https://www.nature.com/articles/s41467-019-09209-7 that blue eyes were present in that population to some degree. Regarding their blonde hair those predictions could be accurate. The Anatolians from Blöcher 2020 have a 30% frequency of light hair. We can only assume that there was a huge variation in pigmentation in early Anatolians too. Some groups likely being almost fully dark haired while others were exhibiting lighter hair and eyes. What we know from said study is that they were light skinned.
Taking all these factors and likely even more into account we also have to account for Bronze Age selection, which is thought to be the decisive factor and is probably what made the phenotype of blond hair+blue eyes so common today.
Like I mentioned it's weird that in modern day these features correlate more with HG ancestry, but in ancient times more with EEF. For these Fatyanovo samples it matches almost 100% with EEF ratios.
So far phenotypes have been a very poor way of determining ancient ancestry, but I think that's largely due to lack of samples/bad modelling. GAC like mentioned could have been the reason for Corded Ware-related people to pick up these traits, but we still can't be sure. If I recall there was some Hungarian farmer sample that had all these light features, and he was pretty close to CW.
@Heyerdahl
"The LP allele was found in a middle Neolithic individual from Sweden (Malmström 2010) that incidentally also had light hair and eyes"
The Middle Neolithic in Sweden is time of CWC in Sweden 4,800-4,200 BP. It is not an ancestor to TRB.
i don't think the Minoans were swarthy
https://genetiker.wordpress.com/pigmentation/
@Davidski, how do you feel about the data from Reich? Z2472?
1341 RISE434.SG RISE434 43891 tooth 2015 AllentoftNature2015 .. Direct: 95.4%; IntCal20, OxCal v4.4.2 Bronk Ramsey (2020); r:5; Atmospheric data from Reimer et al (2020) 4703 73 2880-2629 calBCE (4161В±34 BP, UBA-27946) Germany_CordedWare.SG Tiefbrunn Germany 48.932 12.259 Shotgun 1 0.1 109337 .. M n/a (no relatives detected) R1a1a1b2a2b1a .. U4
13311 s19_X08_1.SG X08 AM?: L1 tooth (molar) 2019 SaagCurrentBiology2019 SaagCurrentBiology2019 Direct: 95.4%; IntCal20, OxCal v4.4.2 Bronk Ramsey (2020); r:5; Atmospheric data from Reimer et al (2020) 2819 31 925-815 calBCE (2733В±26 BP, SUERC-80021 (GU47832) Estonia_BA.SG Harju, LГµokese at Muuksi, cist A Estonia 59.505 25.5281 Shotgun .. 0.256951 269371 .. M n/a (no relatives detected) R1a1a1b1a2b .. T2a1b1a2
13313 s19_X10_1.SG X10 AM?: L3 tooth (molar) 2019 SaagCurrentBiology2019 SaagCurrentBiology2019 Direct: 95.4%; IntCal20, OxCal v4.4.2 Bronk Ramsey (2020); r:5; Atmospheric data from Reimer et al (2020) 3075 54 1218-1017 calBCE (2926В±28 BP, SUERC-80026 (GU47834) Estonia_BA.SG Harju, LГµokese e at Muuksi, cist C Estonia 59.505 25.5281 Shotgun .. 0.188669 204714 .. M n/a (no relatives detected) R1a1a1b2a2b1a .. U5a2a1
@Wise dragon
Then how do you explain nearly all the steppe samples being dark?
@Heyerdahl
I would not take this kind of conclusion seriously. Prediction of phenotypes from the genotype are still inaccurate. HIrisPlex-S, for example, very often misrepresents skin/hair color for samples from west Eurasians and especially east Eurasians. Only the color of the eye can be trusted.
There is also the case of the Kleitos-Greece sample which I've heard was heterozygous and carried one blue-eyes allele.
@Archi
"The Middle Neolithic in Sweden is time of CWC in Sweden 4,800-4,200 BP. It is not an ancestor to TRB."
The Middle Neolithic in Sweden starts 3300 BCE, so it includes the late (megalithic) TRB phase. All Swedish TRB genomes except Saxtorp are Middle Neolithic.
@Angantyr
"The Middle Neolithic in Sweden starts 3300 BCE, so it includes the late (megalithic) TRB phase. All Swedish TRB genomes except Saxtorp are Middle Neolithic. "
The Middle Neolithic in Malmström 2010 in Sweden is time 4,800-4,200 BP only, not 3,300BC. General arguments are useless because chronologies of all authors are different, in Europe everywhere different chronologies, confusion with terminology and each author establishes the periods in his own way, a lot of different names. In general, Malmström 2010 refers to the Eneolithic period of 4,800-4,200 BP with CWC at that time, he calls it the Middle Neolithic.
@Dragonhermit
I'm guessing the blond Neolithic Hungarian farmer sample you mention is sample NE7 from Gamba et al 2014? He had blond hair, blue eyes and light skin. By close to CW you must mean geographically close. Another thing to consider may be that different selections took place in Linear Pottery compared to Cardium Pottery. LBK became increasingly reliant on animal husbandry while CP from what I know were more typically sedentary and grain reliant. In any case the lack of dietary Vitamin D may have been contributing, but not decisive. This is the study https://www.nature.com/articles/ncomms6257
@Archi
The sample I mentioned was one of the Gökhem Funnelbeakers if I'm not mistaken.
@mary
Don't get me wrong, I'm not drawing any conclusions. We still don't know nearly enough to do that. I'm just forming a loose opinion based on the data currently available to us. It's possible that we don't even have the knowledge of how to fully predict phenotypes in ancient human beings. We can predict eye and hair colour decently enough, but when it comes to predictions for things such as genetic height and skin colour of ancient remains we still have a long way to go. Especially such a thing as genetic height is tricky.
@Heyerdahl
"The sample I mentioned was one of the Gökhem Funnelbeakers if I'm not mistaken."
You are wrong, this sample with LP: C/T (not LP=T!) is
Pitted Ware Sweden Ire, Hangvar, Gotland [Ire 3] 2800-2000 BC U4
-------------
It is wrong to judge skin color from the predictors, they are tuned to limited modern populations. It is very bad that in the work on Fatyanovo they did not bring a normal set of mutations, which can be compared with other ancient samples, but brought some kind of abstract and erroneous opinion of a certain predictor that cannot be compared with anyone else.
@Archi
"The Middle Neolithic in Malmström 2010 in Sweden is time 4,800-4,200 BP only, not 3,300BC. General arguments are useless because chronologies of all authors are different, in Europe everywhere different chronologies, confusion with terminology and each author establishes the periods in his own way, a lot of different names. In general, Malmström 2010 refers to the Eneolithic period of 4,800-4,200 BP with CWC at that time, he calls it the Middle Neolithic."
In Scandinavian archaeology there's no significant inconsistencies, only some differences in opinions regarding the exact delimitations. (E.g. does the EN start 4000 BCE or +/-100 years? Does the MN end 2350 BCE or +/-100 years? Does the LN end 1800 BCE or 1700 BCE?)
When Malmström 2010 writes "The samples originate from four archaeological sites on Gotland in the Baltic Sea dating to the Middle Neolithic, 4,800-4,200 BP", it's because her PWC samples span that period, not because the Middle Neolithic does.
Let me quote Malmström 2009: "Skeletal remains from 74 individuals of eight middle-Neolithic sites were initially selected. Of these, 41 yielded sequence data, but only 22 (19 PWC and 3 TRB) met all requirements demanded for authenticity." So, she agrees that TRB existed in the MN.
(The only archaeogenetic publications that mess up Scandinavian Neolithic chronology seem for some reason to be those where Morten Allentoft is involved...)
@Angantyr
The point is that Malmström 2010 does not have any 3300BC and TRB, and not that TRB survives to their late Middle Neolithic, after all, this is just a set of words that they define as they want. I consider all their definitions arbitrary, I consider all their definitions of the Neolithic periods delusional. This is no good when some write about the BBC or the CWC as Bronze Age cultures, while others write about them as Late or Middle Neolithic cultures.
Some changes regarding Proto-Indo-European are expected soon:
https://twitter.com/NirajRai3/status/1351938165708267520
The chronological division in Scandinavia is well agreed & adhered. Archie is just making things up as usual
@All
Has anyone who actually knows what they're doing looked at the Fatyanovo Y-chromosomes yet?
@Davidski
"Has anyone who actually knows what they're doing looked at the Fatyanovo Y-chromosomes yet?"
Are you talking about this paper from 20 Jan 2021?:
https://tinyurl.com/y62nsrvf
"Then, we turned to the Bronze Age Fatyanovo Culture individuals and determined that they carry maternal (subclades of mtDNA hg U5, U4, U2e, H, T, W, J, K, I, and N1a) and paternal (chrY hg R1a-M417) lineages (Table 1, fig. S1, and tables S2 to S4) that have also been found in CWC individuals elsewhere in Europe (14–16, 18, 27). In all individuals for which the chrY hg could be determined with sufficient depth (n = 6), it is R1a2-Z93 (Table 1 and tables S1 and S2), a lineage now spread in Central and South Asia, rather than the R1a1-Z283 lineage that is common in Europe (36). R1a2-Z93 is also not rejected for the individuals that were determined with less depth due to missing data on more apical markers (table S2)...We estimated the time of admixture for Yamnaya and EF populations to form the Fatyanovo Culture population using DATES as 13 ± 2 generations for Yamnaya Samara + Globular Amphora and 19 ± 5 generations for Yamnaya Samara + Trypillia. If a generation time of 25 years and the average calibrated date of the Fatyanovo individuals (~2600 cal BCE) are used, this equates to the admixture happening ~3100 to 2900 BCE."
Yes, but I mean in more detail than what was in the paper.
@Archi
You have to be more constructive with your criticism if you want me to approve your comments from now on.
@CrM
"Dagestanis for example are the most Steppe admixed Caucasians…. They're also by far the swarthiest North Caucasians and among the swarthiest Caucasians as a whole"
Maybe it's the descendants of the Arabs hehe, (when was the conquest of Dagestan (Sarir)) «Tarikh al-Bab» chronicle: "In the reign of Hisham (105-25/724-43), Maslama is said to have established in Darband 24,000 Syrians and assigned stipends to them" also from it "caliph Abu-Ja'far (136-58/754-75) liberated 7,000 men detained in prison and sent them to Darband"
According to Genko A.N. the inhabitants of Darbakh still spoke Arabic in the beginning of the 20 century.
Or maybe the fair ones were taken out by arabs hehe, al-Kufi in Kitāb al-Futūḥ «Book of Conquests»: "Marwan gave him his consent to this, and a truce was concluded between them on the terms of the annual delivery by the ruler of al-Sarir to the city of al-Bab 500 ghoulams, 500 blond, with long eyelashes, sensual virgin concubines, 10 thousand dinars and 500 mudd of provision"
If seriously, you have obviously never met Armenians/Azeris and North Caucasians. Yes, in general Dagestanis have dark hair and eyes, although among them occur fair also, the most famous Dagestani, imam Shamil (from Avars) https://pbs.twimg.com/media/EaWELXfXYAEICGl.jpg:large
The swarthiest are Armenians/Azeris. North Caucasians in general (including Dagestanians) are lighter in skin,
left Dagestanian (from Laks) right Armenian compare https://sun1-86.userapi.com/c855536/v855536809/167653/RpROHHlcgzA.jpg
"although I'm not quite sure how accurate the predictions are"
That's where you should have started from. All these pigmentation traits - speculation. Remember how in mass media said that the Cheddar man was black referring to geneticist . Then the geneticists said that they still didn't know what his pigmentation was https://www.dailymail.co.uk/sciencetech/article-5453665/Was-Cheddar-man-white-all.html
@old europe
Genes for fair hair and eyes (as well as skin) are recessive genes, if a fair female farmer mixed with a dark male farmer, children with a high degree of probability would not be fair, because of father’s dominant genes. The same situation would be with the dark male steppe pastoralists. These genes would be suppressed at the beginning. "hair color I will take from this population, eye color from this population, skin color from this population" genes don't work like that.
@Romulus
"i don't think the Minoans were swarthy
https://genetiker.wordpress.com/pigmentation/"
They were. See my links to the pictures above
@Draft Dozen
Parts of your last comment are against the rules. You need to tone things down.
@Draft Dozen
"Maybe it's the descendants of the Arabs hehe"
No, for they do not score any Arab-related ancestry, see https://i.imgur.com/tX76roV.png. The Khazars had an even greater presence in Dagestan, but even they did not leave a significant genetic impact, let alone Arabs. And Marwans reign was pretty short to leave a lasting demographic impact, considering his defeat in Abkhazia. Dagestanis were also notorious raiders and kidnappers, "blonde" Dagestanis are a very rare sight and the bulk of those so called blonde concubines could have been kidnapped non-Dagestanis. There's a famous Dagestani song about their raider Rajbadin, the song mentions them kidnapping "Golden-haired Kakhetian women", which is amusing cindering the fact that Kakheti has the swarthiest people in Georgia; those are just exaggerations, much like the sources that you've quoted.
Btw, the song in question: https://www.youtube.com/watch?v=6uPlP1wYSiM you can also observe their phenotypical variance, not a single light Dag in sight.
You might as well check the Georgian response to Rajbadin's raids if you're interested: https://www.youtube.com/watch?v=SMaRWrqtYhQ
"If seriously, you have obviously never met Armenians/Azeris and North Caucasians."
Amusing, I literally live in the Caucasus, and your point of Imam Shamil is moot, for there are outliers everywhere, but even Imam Shamil is a bad example considering that he used henna to dye his hair and beard.
"The swarthiest are Armenians/Azeris. North Caucasians in general (including Dagestanians) are lighter in skin,"
I quote myself "They're also by far the swarthiest North Caucasians (which is true, they are indeed swarthier than Nakh or Northwest Caucasians) and among the swarthiest Caucasians as a whole (after Azeris and Armenians).
"That's where you should have started from. All these pigmentation traits - speculation."
Eye color is the least speculative aspect of pigmentation prediction, and you could see Kura-Araxes and Maykop scoring more light eyes than Yamnaya/Catacomb. Yamnaya/KAC/Maykop skin and hair color predictions are about the same, which is reflected in the phenotypical variance of Dagestanis.
South Asian population history is quite interesting from what I've seen.
Indo-Aryans are differentially related to North and West Eurasians, with the generally more NW populations being closer to them. Uttar Pradesh Muslims, Jats, Syeds and Gujarati Muslims are the most distant from NW Eurasians while Kalash, Pashtun, Ror, Sindhi Pakistan are all closer.
The latter group (Kalash, Ror, Pashtun, Sindhi) are also closer to Gujarati (specfically GujaratiB), which has the most shared drift with tribal Indians (ONG and Birhor)
As you can see Pathan is closer to GujaratiB than it is to Gujarati Muslim and Jatt.
result: Pathan GujaratiB Chimp.REF 223.135175 1.053569 211.790 93257
result: Pathan Control Chimp.REF 221.870059 1.167833 189.984 92669
result: Pathan Jatt Chimp.REF 223.094137 1.171180 190.487 92082
result: Pathan Kalash Chimp.REF 223.717346 1.046873 213.701 93668
For Gujarati Muslim, both Onge (AASI) and NW Eurasians are closer to GujaratiB.
1 ONG.SG GujaratiB Chimp.REF 217. 1.17 185. 87309
2 ONG.SG G_Muslim Chimp.REF 216. 1.29 167. 75592
6 Russia_MLBA_Sintashta GujaratiB Chimp.REF 223. 1.09 204. 90073
7 Russia_MLBA_Sintashta G_Muslim Chimp.REF 222. 1.19 186. 85524
11 English GujaratiB Chimp.REF 222. 1.07 209. 92050
12 English Control Chimp.REF 221. 1.19 187. 90033
This is not the case with Jatt who is further from ONG and closer to NW Eurasians than GujaratiB. I cant check Uttar Pradesh Muslims and Syeds as I dont have that data in this set.
So it looks like NW South Asians are the result of South to North movements originating around the Gujarati Sindh coastal areas. This could be related to Zebu domestication. The earliest people to separate out from this core NW group are the Gujarati Muslim, UP Muslim, Syed, Jatt cluster (EastIA). This group must have moved North and Eastward to populate Eastern Punjab from Gujarat-Sindh.
A second group consisting of Ror, Kalash, Kalash, Pathan and others (WestIA) are closer to GujaratiB and also to NW Eurasians so they must have been a later cluster in the NW Coastal region (Sindh, Sistan, KP, West Punjab) from where they spread Eastwards (late Vedic and Hinduism) and are connected to NW Eurasians.
The EastIA cluster (Gujarati Muslim, UP Muslim, Syed, Jatt) looks like a more ancient NW South Asian IE group which does not share much drift with NW Eurasians compared to the Western IA group.
Why was there always so much doubt about Trypillia contributing to CWC related groups? I could never understand that.
https://www.nature.com/articles/s42003-020-01627-4 - shotgun Wartburg late Neolithic with high HG.
It is often proposed that Beaker EEF ancestry from a high HG population, so perhaps these on G25 would help test that (e.g. Beaker EEF maybe a composite of this culture, GAC, general Atlantic farmer etc)
Immel data - https://www.ebi.ac.uk/ena/browser/view/PRJEB35327
With this comment, I will end our pigmentation discussion.
Yes, the Dagistanians have more Iranian-like influence, probably through Sassanian Persia. Although, it must be said, that since the Abbasids, there were sizable number of mercenaries in the Arab army, they might be of non-Arab origin.
"Kakheti has the swarthiest people in Georgia"
This is a widespread opinion in Georgia, Kakhetians are the swarthiest, Svans are the fairest in the country. But there are other opinions about this.
"Imam Shamil is a bad example considering that he used henna to dye his hair and beard"
This is just an example, that the most famous, were the fair one. He didn't dye his hair with henna, the muslims of those times dyed only their beards. And judging by the portraits, he wasn't swarthy and his eyes weren't brown.
"I quote myself"
Then I didn't fully understand you, thought you were saying that Dagestanians are the swarthiest among whole Caucasians.
"Eye color is the least speculative"
User weure and his father have the Herc2 SNP for blue eyes rs12913832 GG, but both have chesnut eyes. So, I'm still skeptical.
Re: the supposed L51 in RISE550
HWI-D00708:28:C6GU8ANXX:3:1306:15919:28490 16 Y 8502185 37 61M * 0 0 GTGTGAGAAGAAATAAGGTGAGATATGGACGGGGGTACAATCTGATGAGGCGTGGATAGGG GGGGGGGGGGGGGGGGGGGGGGGGEGCCC=ADC>:1GGGGGGGGGGGGGGGGGGCEABBAA X0:i:1 X1:i:0 MD:Z:51A9 PG:Z:MarkDuplicates RG:Z:RISE550_0 XG:i:0 NM:i:1 XM:i:1 XO:i:0 XT:A:U BQ:Z:B@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@A
Negative call for L51:
chr pos marker_name haplogroup mutation anc der reads called_perc called_base state
chry 8502236 L51 R1b1a1b1a G->A G A 1 100 G A
All calls below L23 that are not below L51 (so basically whole Z2103 branch is one big "no call"):
chry 7171949 L943 R1b1a1b1b1a T->A T A 2 100 T A
chry 7046288 BY250 R1b1a1b1b3a1a1b A->G A G 1 100 A A
At best it's R-PF6535(xL51).
@EastPole
Some changes regarding Proto-Indo-European are expected soon
I6561 is from the middle bronze age, I6222 is contaminated, still no L51 in Yamnaya - certainly PIE homeland is moving even further west.
@Draft Dozen
The Iranian influence is Azeri, not Iranian proper, and it peaks in the south among the Lezgics, who have been intermixing with Azeris. It's absent in Darginians and in some of their subethnic groups. Far as phenotypes are concerned, Dargins don't look much different from other Dagestanians. Also, Kura-Araxes itself was pretty rich in Iran_N ancestry, it's a result of a merge between several cultures, with some of them being born in Iran.
And yeah, there's a West/East Divide in Georgia, with West generally being lighter than East.
Shamil was green eyed and probably pale, but I doubt that he was a redhead. That's the first thing that catches your eyes when you see the image you posted, the image also seems heavily processed. There's another one where he has a visibly dark beard turned dark orange thanks to henna, and several others where his beard is black.
On a related note,
Kubano-Tersk late is a pretty interesting sample, Dagestanis can derive ~55% of their ancestry from them on average. But it's slightly different from Catacomb proper, biggest difference being the extra Maykop-related ancestry. It is probably going to be similar to the Novotitarovskaya culture.
https://i.imgur.com/0m3Qgix.png
Reich Lab abandons 1240k:
https://www.youtube.com/watch?v=xF18mYe5WoA
Some new Pictish aDNA:
https://www.youtube.com/watch?v=sdqW-RwyUXQ&t=983
It's a matter of fact, that all populations that are EEF- rich or largely of EEF extraction are mostly swarthy. Besides, in the Lazaradis paper the analysis of the phenotype of Minoans/Mycenaeans predicted them to be dark haired and brown-eyed, thus as typical Mediterranean looking folks. Here's the thing, among populations where the Steppe admixture was higher than the EEF ancestry, higher rates of blondism, blue eyes and very pale skin started to pop up. Keep in mind that the Anatolian farmers had dark eyes, however EEF had 7% more WHG admixture. Therefore, EEF displayed sometimes blue eyes, do to their genes from the WHGs.
@CrM
"Dagestanis for example are the most Steppe admixed Caucasians…. They're also by far the swarthiest North Caucasians and among the swarthiest Caucasians as a whole"
I have seen people from Dagestan, some were swarthy, while others were pale with light eyes and hair.
As ive suggested previousy, there's no singular population which BB mixed with, theyd all be similar along the lnes of Warberg, GAC, etc. This is what context tells us, I dont think theres any clever stats that can suggest otherwise.
Also interesting mix of HG-lineages here - predominant I2c (Boleraz, Unetice), also finds of I2a1a; I2a2a2 (<- links to northern Iberia pre-Beaker Copper Age + a Czech CWC outlier)
@Draft Dozen
Blue eyes being recessive is debunked nonsense. There are plenty of biracial people today that carry and express all sorts of genes for light hair, light eyes or skin.
@Bob Floy,
Looking on a map it makes sense Corded Ware had Trippla admixture. But when looking at the DNA it doesn't.
The earliest Corded Ware have no Farmer ancestry. Meaning when Corded Ware left the Steppe they had no Farmer ancestry.
Second, Globular Amphora always comes out as the best proxy for Corded Ware's farmer ancestry in G25 runs. Not just for Corded Ware but also its derivatives: Bell Beaker, Sintashta.
@DragonHermit
"Blue eyes being recessive is debunked nonsense. There are plenty of biracial people today that carry and express all sorts of genes for light hair, light eyes or skin."
Not really. The vast majority of biracial folks have dark eyes, those with light eyes are the exception that prove the rule. Besides, many biracial people who display blue/green eyes, have on their black side actually distant European ancestry.
@Rob,
I suppose you are right there are multiple sources for farmer ancestry in Bell Beaker. But I still think Globular Amphora possibly in addition TRB are the main source.
U5b2b2 is an mtDNA in Wartberg, and pops up in I think four Bell beakers. It is a unique and old U5b line. This is from Wartberg like farmers in Western Europe.
@Rob,
"Also interesting mix of HG-lineages here - predominant I2c (Boleraz, Unetice), also finds of I2a1a; I2a2a2 "
This is a good candidate for where the Y DNA I2 in Unetice comes from.
The mix of Y DNA is surprising considering all of the patri-local communities we have found in Neolithic, Bronze age Europe.
@Arza
"I6561 is from the middle bronze age, I6222 is contaminated, still no L51 in Yamnaya - certainly PIE homeland is moving even further west."
There is no logic.
I agree with Archi I6561 is Srubnaya not Sredny Stog. Now they call him Middle Bronze age. So..........
@Wise Dragon
Yeah, the "hybrids" of the original Steppe/EEF people would've mixed with others like themselves, and pass whatever features to one other. They will carry either feature from both sides of the family.
I suspect the Lengyel Culture was probably ground 0 for these features as shown by Lengyel NE7, but I could be wrong. NE7 is the first time we see all these features combined in Europe outside of the SHGs which are (mostly) a genetic dead end.
as for the I6561 I would say that we have to be cautious. If it is from Srubnaya why this sample prefers a balkan EEF admixture? Srubnaya is corded ware related and we know that all these cultures overwhelmingly prefer GAC EEF admixture. Besides we have R1a samples close to the carpathians and rumors about usatovo r1a. Clearly they came from the same region where I6561 was founded. So I do not think the overall picture will change. something very to similar to I6561 will be found anyway in eneolithic ukraine.
@ genos historia
I think we have 4 early baltic CWC sample. One as you said is very low farmer. The other 3 IIRC have EEF level between 25/30%.
@old europe,
There's one Early Balti CWCs ones who has basically 0% farmer: I4629
Then there's a two who have under 10-15 farmer: Gyvakarai1, Plinkaigalis242
Later Baltic CWC RISE00 has 25-30% Famer.
@old europe,
There's also an early Corded Ware in Poland who has 0% Famer. The only difference with Yamnaya is he has less CHG. He has R1a M417.
@Wise Dragon
If Steppe ancestry (Steppe_EBA) was the vector for light hair, eyes etc then Dagestanians would have been lighter than Ossetians, Chechens, Ingush, Karachai-Balkar, Abkhaz, Abazins, Adyghe and West Georgians, but they're not. And if we're to follow the logic that all Anatolians were swarthy, then Dagestanians would have also been lighter than (or as light as) Yugoslavs, but that's also not the case. Even Finnish Steppe_EBA ancestry % isn't far off from Dagestanian.
https://i.imgur.com/UQv1qM4.png
We can see a correlation between light pigmentation and several specific Anatolian and Hunter-Gatherer ancestries, and whenever you see a majorly depigmented Steppe population, then said Steppe population also harbors some additional Anatolian-related ancestry.
@CrM,
Judging by Google Images, all you Caucasians are more white skinned than other southwest Asians. Including Dagestani. Armenians and other people with less CHG seem darker.
This might be due to high frequency of rs16891982 G% in Caucasus. Dagestan has 81% which is close to Europe.
https://www.ncbi.nlm.nih.gov/snp/rs16891982#frequency_tab
It is possible there has been selection for white skin recently in the Caucasus too.
@CrM,
There isn't one example of a very Blonde Neolithic farmer population yet. So there isn't evidence yet this is where blondism comes from.
There's low coverage Globular Amphora samples who seem to be blonde but the newer high coverage samples are all swarthy like all Neolithic Europeans.
Funnel Beaker and Globular Ampora haven't be covered a lot however. Yet, I still doubt they will be any different than other Neolithic Europeans.
rs12821256 in KITLG has been confirmed to be from Kurgan. It is one of the few SNPs, other than one in SLC45A2 and OCA2, associated with blonde hair. It is not a powerful SNP but it does help cause blonde hair. It went from ANE to EHG to Kurgan.
@genos
the problem is that in the baltic there were zero EEF girls to marry. You seem to miss this crucial point. Besides genetic seems to back up the thesis that eastern corded ware and baltic corded ware were Yamnaya derived on the maternal side. Or tu put it another way: baltic CWC did not marry out but their female ancestry came from the steppe. Only in the western corded ware exogamy network sterted to become relevant and western farmers genetic dna increased the EEF level of steppe pastoralists.
https://www.nature.com/articles/s41598-018-29914-5
The Anatolian stuff in Steppe MLBA is not necessarily EEF. This could be Anatolian that differentiates Southern Steppe DNA from more ANE like Northern Steppe peoples.
If this is the case then Steppe MLBA should have more CHG than a simple mixture of Yamnaya+EEF would predict, as EEF has little CHG, but there would be more CHG in the Southern Steppe region (Central Asia and North Caucuses).
Wouldn't the parsimonious explanation be that steppe_emba and late EEFs had varying amounts of the derived alleles of slc45a2, fixed for the derived slc24a5 one, and both clusters had varying amounts of blondism/blue eyes while the vast majority did not?
The increase later on comes from as these peoples began to mix and there was a strong selection event which progressively made people fairer.
@Genos Historia
"Judging by Google Images, all you Caucasians are more white skinned than other southwest Asians."
Yeah, I suppose, although I wouldn't categorize the Caucasus into SOUTHwest Asia. The thing with Dagestanians is that they're in a rather peculiar place genetically. You'd expect a 60/40 Georgian-like/Yamnaya population to be the lightest in the North Caucasus, but no.
I too believe that there was a selection in the Caucasus, much like in many other places in the world. The process in the Caucasus probably began in the Early Bronze Age, with Maykop and KAC exhibiting some prevalence of light eyes and light skin. Georgia for instance used to have specific regional phenotypes in every different Valley and Ravine.
Steppe_EBA though, as multiple evidences show, didn't undergo a selection for light traits, that happened only later, after they mixed with GAC and with other farmer and HG groups.
"There's low coverage Globular Amphora samples who seem to be blonde, but the newer high coverage samples are all swarthy like all Neolithic Europeans. "
ILK001, ILK002, ILK003 (Ukrainian GAC) are all high coverage and are blonde/dark blonde. I've seen I3708, I3709 (Greek Neolithic farmers, also high coverage) having light hair prediction as well. I really doubt "ALL" farmers/Anatolians were swarthy. Hell, you have blonde/red haired native West Georgians with next to 0 Steppe ancestry. Same with East Georgians (who are more rare, though), but they probably score more Yamnaya so I won't use them for this argument.
"rs12821256 in KITLG has been confirmed to be from Kurgan. It is one of the few SNPs, other than one in SLC45A2 and OCA2, associated with blonde hair. It is not a powerful SNP but it does help cause blonde hair. It went from ANE to EHG to Kurgan."
I checked rs12821256 frequency and it's 0.0310 in Dagestan vs 0.235 in Sweden. Even Qataris (where's their ANE/EHG/Kurgan?) score more than Dagestanians at 0.037. Did I get this right?.
https://www.ncbi.nlm.nih.gov/snp/rs12821256#frequency_tab
@mzp1
The EEF in Steppe_MLBA is actually Middle Neolithic EEF, and more precisely Globular Amphora admixture.
Get another hobby you clown.
@All
The following samples have been added to the Global25.
https://drive.google.com/file/d/15rAt9-5yFwtM7ISuv9sKXmQjK8vuv_oB/view?usp=sharing
Same links as usual.
Please let me know if I should re-label some of the entries after that major update to the Harvard anno file.
@old europe,
Yeah, there were no farmers in Baltic before Corded Ware. This confused me too. But, then I realized this just means the ones with farmer ancestry migrated to Baltic from somewhere in south in later Corded Ware period. Migration within Corded Ware.
Why are some of the Xiongnu labelled 'RUS" ?
e.g. RUS_Late_Xiongnu_Sarmatian
Distance to: UKR_Alexandria1:I6561 to Fatyanovo
0.01814552 RUS_Potapovka_MLBA:I0419
0.01911596 RUS_Sintashta_MLBA:I1086
0.02050415 RUS_Sintashta_MLBA:I1082
0.02143992 RUS_Sintashta_MLBA:I1064
0.02236940 RUS_Sintashta_MLBA:I1029
0.02252443 RUS_Sintashta_MLBA:I0939
0.02265635 RUS_Fatyanovo_BA:NIK008AB
0.02337135 RUS_Sintashta_MLBA:I1089
0.02351468 RUS_Sintashta_MLBA:I1055
0.02360339 RUS_Karasuk:RISE499
0.02381155 RUS_Sintashta_MLBA:I1011
0.02394828 RUS_Sintashta_MLBA:I1027
0.02400750 RUS_Srubnaya_MLBA:I0234
0.02405639 RUS_Poltavka_o:I0432
0.02434173 RUS_Sintashta_MLBA:I1088
0.02453385 RUS_Sintashta_MLBA:I1084
0.02466921 RUS_Srubnaya_MLBA:I0232
0.02485739 RUS_Sintashta_MLBA:I0984
0.02495316 RUS_Sintashta_MLBA:I1024
0.02499800 RUS_Srubnaya_Alakul_MLBA:mur003
0.02523787 RUS_Sintashta_MLBA:I7480
0.02545408 RUS_Srubnaya_MLBA:I0361
0.02621431 RUS_Srubnaya_MLBA:I0424
0.02626195 RUS_Srubnaya_Alakul_MLBA:kzb009
0.02692174 RUS_Srubnaya_MLBA:I0430
0.02704385 RUS_Srubnaya_MLBA:I0359
0.02720662 RUS_Srubnaya_MLBA:I0431
0.02737554 RUS_Sintashta_MLBA:I1090
0.02746543 RUS_Srubnaya_Alakul_MLBA:kzb006
0.02750036 RUS_Srubnaya_Alakul_MLBA:kzb001
0.02750236 RUS_Petrovka_MLBA:I0945
0.02766550 RUS_Sintashta_MLBA:I1053
0.02768772 RUS_Sintashta_MLBA:I1018
0.02774419 RUS_Sintashta_MLBA:I0986
0.02775860 RUS_Srubnaya_Alakul_MLBA:kzb008
0.02794047 RUS_Srubnaya_Alakul_MLBA:kzb007
0.02854120 RUS_Sintashta_MLBA_o2:I1057
0.02862307 RUS_Srubnaya_Alakul_MLBA:kzb002
0.02897395 RUS_Sintashta_MLBA:I1022
0.02905340 RUS_Srubnaya_MLBA:I0235
0.02927115 RUS_Fatyanovo_BA:VOR004
0.02964169 RUS_Srubnaya_MLBA:I0358
0.02976827 RUS_Sintashta_MLBA:I1065
0.02993526 RUS_Sintashta_MLBA:I1061
0.02994812 RUS_Srubnaya_MLBA:I0422
0.03016604 RUS_Fatyanovo_BA:HAN004
0.03025607 RUS_Sintashta_MLBA:I1019
0.03092636 RUS_Karasuk:RISE502
0.03100806 RUS_Sintashta_MLBA:I0987
0.03107813 RUS_Srubnaya_Alakul_MLBA:mur004
0.03138391 RUS_Fatyanovo_BA:HAN002
0.03149889 RUS_Fatyanovo_BA:NAU001
0.03155139 RUS_Sintashta_MLBA:I0943
0.03169464 RUS_Sintashta_MLBA:I1060
0.03180833 UKR_Srubnaya_MLBA:MJ08
0.03195591 RUS_Fatyanovo_BA:HAL001
0.03363168 RUS_Fatyanovo_BA:NAU002
0.03370860 RUS_Sintashta_MLBA:I1063
0.03371157 RUS_Priobrazhenka_LBA:I6047
0.03385070 RUS_Srubnaya_MLBA:I0423
0.03408357 RUS_Sintashta_MLBA:I1008
0.03491504 RUS_Sintashta_MLBA:I1012
0.03518210 RUS_Sintashta_MLBA:I0989
0.03649246 RUS_Sintashta_MLBA:I1062
0.03677676 RUS_Fatyanovo_BA:IVA001
0.03754011 RUS_Fatyanovo_BA:BOL003
0.03773659 RUS_Sintashta_MLBA_o2:I1020
0.03796235 RUS_Poltavka:I0371
0.03852246 RUS_Srubnaya_Alakul_MLBA:kzb003
0.04279650 RUS_Potapovka_MLBA_o:I0246
0.04290886 RUS_Poltavka:I0126
0.04291247 RUS_Karasuk:RISE495
0.04373088 RUS_Sintashta_MLBA:I0942
0.04477912 RUS_Poltavka:I0374
0.04528786 RUS_Steppe_Maykop_o:IV3002
0.04550286 RUS_Poltavka:I7671
0.04688518 RUS_Poltavka:I0440
0.04735177 RUS_Potapovka_MLBA:I7670
0.04849051 RUS_Karasuk:RISE496
0.04897601 RUS_Fatyanovo_BA:VOD001
0.04897765 RUS_Poltavka:I8745
0.05042291 RUS_Poltavka:I6294
0.05158168 RUS_Steppe_Maykop_o:AY2001
0.05231482 RUS_Steppe_Maykop_o:SA6013
0.05354503 RUS_Progress_En:PG2001
0.05373276 RUS_Sintashta_MLBA_o2:I0983
0.05733132 RUS_Khvalynsk_En:I0434
0.05801560 RUS_Khvalynsk_En:I0122
0.05814723 RUS_Progress_En:PG2004
0.05925184 RUS_Khvalynsk_En:I0433
0.06026782 RUS_Srubnaya_MLBA_o:I0354
0.06057854 RUS_Potapovka_MLBA_o:I0244
0.06316882 RUS_Steppe_Maykop:SA6004
0.06783502 RUS_Steppe_Maykop:SA6001
0.07115392 RUS_Steppe_Maykop:AY2003
0.07193740 RUS_Sintashta_MLBA_o3:I1028
0.07255846 RUS_Sintashta_MLBA_o1:I1017
0.07258857 RUS_Sidelkino_HG:Sidelkino
0.07808316 RUS_Samara_HG:I0124
0.08053987 RUS_Karelia_HG:UzOO77
0.08068377 RUS_Karelia_HG:I0061
0.08295897 RUS_Veretye_Meso:PES001
0.08385887 RUS_Sosnoviy_HG:I5766
0.08813734 RUS_Karasuk_o:RISE497
0.08915806 RUS_Karelia_HG:I0211
0.09247513 RUS_Sintashta_MLBA_o1:I1007
Target: UKR_Alexandria1:I6561
Distance: 1.1416% / 0.01141582
62.8 RUS_Sintashta_MLBA
15.0 RUS_Petrovka_MLBA
13.0 RUS_Fatyanovo_BA
9.2 RUS_Srubnaya_MLBA_o
@ Davidski
NO RUS_Sosonivoy_HG, it must be RUS_Sosnoviy_HG.
Alexandria is a very multi-layered monument, there are settlements and a burial ground of different times from the Neolithic to the Bronze Age inclusive. Kotova denies that the burial ground belongs to the Sredny Stog and Derivka culture, on the grounds that there was a settlement in its place at that time, and in Eastern Europe they never buried it for the settlement, all the burial grounds are no closer than half a kilometer from the place of settlement. She attributes it to the Constantinovka culture. People of Donetsk Neolithic culture and Repin culture settled there. In the Bronze Age, there was a culture of Mnogovalikovaya ceramics (Babino) from which a lot of ceramics remained and was the site of the Abashevo culture. According to genetic data, it is now clear that the Potapovka culture could be there that was the predecessor of the Srubnaya culture, but the classical Srubnaya culture itself was not there.
@DragonHermit
Lol. Most people of multiracial ancestry in the Americas are not first generation "mestizos". I mean, both parents are / may have multiracial inheritance. Many African Americans have a significant share of European ancestry, and they don't even know it. What you are seeing then, is a person who despite being of mixed race, is homozygous for the SNP in question.
Thanks! Can you do KAR001 and GOL001 as low quality samples?
when will harvard reupload the compiled eigenstrat dataset? earlier it was password protected now it says page not found.
Some of the Fatyanovo samples show slight Greek-Balkan-Anatolian shift:
Target: RUS_Fatyanovo_BA:I20784
Distance: 2.7083% / 0.02708345 | R4P
48.0 RUS_Sintashta_MLBA
27.6 RUS_Sintashta_MLBA_o2
17.4 Cypriot
7.0 Baltic_LVA_MN
Target: RUS_Fatyanovo_BA:NIK008AB
Distance: 1.3672% / 0.01367164 | R4P
44.4 Corded_Ware_CHE
23.8 Corded_Ware_POL_early
18.4 Corded_Ware_Proto-Unetice_POL
13.4 Cypriot
Target: RUS_Fatyanovo_BA:IVA001
Distance: 2.0684% / 0.02068419 | R4P
37.8 Corded_Ware_POL_early
28.4 Corded_Ware_POL
21.6 GRC_Mycenaean
12.2 Baltic_LVA_HG
In case of I20784 and IVA001 it may be just an artefact (a counterbalance to Baltic_LVA_MN and Baltic_LVA_HG respectively) but at least in the case of NIK008AB it seems to be real. It's definitely worth checking with qpAdm.
There is also one that shows the Balto-Slavic drift:
Target: RUS_Fatyanovo_BA:VOD001
Distance: 2.7506% / 0.02750607 | R4P
29.0 DEU_LBK
28.4 RUS_Sintashta_MLBA
26.8 Corded_Ware_DEU
15.8 Baltic_EST_BA
So where was the starting point of migration of Fatyanovians? Middle Dnieper? Or rather it was an area closer to the Carpathian Mountains? Subcarpathia? Glavanesti?
https://twitter.com/iosif_lazaridis/status/1352772293202767874?s=20
I2181 is now the oldest R1b M269+ from Bulgaria 4500 B.C.
@Rob
That late Xiongnu site is in Russia.
https://www.cell.com/cell/pdf/S0092-8674(20)31321-0.pdf
@Arza
These are shotgun sequences and they haven't been genotyped with the Harvard pipeline like the rest of the dataset, so the southern pull is likely to be an artifact of this. I've seen it happen before.
@Dave
Thanks for the new samples as always.
My understanding is you recently converted some modern Asian samples (like the Khasi) to G25 coords. Is it possible to make those public as well?
@ Romulus
https://twitter.com/iosif_lazaridis/status/1352772293202767874?s=20
I2181 is now the oldest R1b M269+ from Bulgaria 4500 B.C.
That's old news:
https://eurogenes.blogspot.com/2020/03/the-origins-of-east-asians-wang-et-al.html?showComment=1585495368417#c4751030119646786083
Arza said...
"Some of the Fatyanovo samples show slight Greek-Balkan-Anatolian shift:
Distance: 2.7083% / 0.02708345 | R4P
17.4 Cypriot
21.6 GRC_Mycenaean"
This is an R4P-cut artifact since you are using the descendant populations of the Fatyanovo culture as its ancestors. Cypriot and GRC_Mycenaean are all descendants of Fatyanovo in the classical anthropological-archaeological scheme: Fatyanovo + Middle Dnieper -> Babino -> Greece.
2.7% is very poor distance ~ lowest probability. (For example R3P Good distances look at https://eurogenes.blogspot.com/2021/01/david-anthony-on-y-haplogroup-r1a.html?commentPage=2)
RUS_Sintashta_MLBA cannot be ancestor to RUS_Fatyanovo_BA.
@Michalis
I was able to run these, but I don't know what most of then are.
https://drive.google.com/file/d/1KdQMZbSg46aXDiSmKmwYlD61RtS136UM/view?usp=sharing
@Dave
Thank you, brother, I'll sort 'em out.
@Arza
“Some of the Fatyanovo samples show slight Greek-Balkan-Anatolian shift:”
I noticed that some Fatyanovo samples prefer TRB over Globular_Amphora. TRB is more Anatolian shifted.
I am searching for the explanation of the split between Balto-Slavic and Indo-Iranian. In my pet theory, which needs testing, I assume that there was common Indo-Slavic CWC R1a dominated culture which originated from mixing of some CWC_early tribes from the steppe with TRB and TRB-HG admixed tribes, not Globular Amphora. Globular Amphora was an enemy because archeologists tell us that there was no much trade and cooperation between CWC and GAC. Then around 2900 BC GAC, an enemy culture, expanded into Ukraine and Belarus and split Indo-Slavic CWC in half, western part which evolved into Balto-Slavic CWC and eastern Indo-Iranian CWC which became Middle Dnieper and then evolved into Fatyanovo etc. For centuries there was no trade between Middle Dnieper culture and CWC in Poland which may be caused by GAC blocking migrations between MD and CWC.
Target: RUS_Fatyanovo_BA:VOD001
Distance: 3.8769% / 0.03876916 | R5P
59.0 Corded_Ware_Baltic_early
30.2 POL_TRB
9.4 POL_Globular_Amphora
1.4 UKR_Trypillia
Target: RUS_Fatyanovo_BA:HAN002
Distance: 2.7329% / 0.02732883 | R5P
76.4 Corded_Ware_Baltic_early
18.0 POL_TRB
5.6 UKR_Meso
Target: RUS_Fatyanovo_BA:BOL003
Distance: 2.9532% / 0.02953174 | R5P
63.0 Corded_Ware_Baltic_early
17.4 POL_TRB
13.8 UKR_Meso
5.8 POL_Globular_Amphora
Target: RUS_Fatyanovo_BA:HAL001
Distance: 3.3348% / 0.03334796 | R5P
72.0 Corded_Ware_Baltic_early
16.6 POL_TRB
11.4 Corded_Ware_POL_early
Target: RUS_Fatyanovo_BA:NIK008AB
Distance: 2.2927% / 0.02292679 | R5P
38.2 Corded_Ware_POL_early
31.2 Corded_Ware_Baltic_early
16.8 POL_TRB
10.4 POL_Globular_Amphora
3.4 UKR_Trypillia
Target: RUS_Fatyanovo_BA:NAU001
Distance: 2.9646% / 0.02964622 | R5P
60.0 Corded_Ware_Baltic_early
13.2 Corded_Ware_POL_early
13.0 POL_TRB
12.2 POL_Globular_Amphora
1.6 UKR_N
Target: RUS_Fatyanovo_BA:NAU002
Distance: 2.4898% / 0.02489813 | R5P
66.2 Corded_Ware_POL_early
16.0 POL_Globular_Amphora
8.6 POL_TRB
5.2 UKR_Trypillia_En
4.0 UKR_N
Target: RUS_Fatyanovo_BA:IVA001
Distance: 2.3732% / 0.02373239 | R5P
63.6 Corded_Ware_POL_early
19.8 POL_Globular_Amphora
9.6 UKR_Globular_Amphora
7.0 UKR_N
Target: RUS_Fatyanovo_BA:HAN004
Distance: 2.3068% / 0.02306841 | R5P
68.2 Corded_Ware_POL_early
21.4 POL_Globular_Amphora
5.4 UKR_Trypillia_En
4.2 UKR_Meso
0.8 POL_TRB
Target: RUS_Fatyanovo_BA:VOR004
Distance: 2.3316% / 0.02331588 | R5P
51.8 Corded_Ware_Baltic_early
27.8 POL_Globular_Amphora
16.0 Corded_Ware_POL_early
4.0 RUS_Veretye_Meso
0.4 UKR_N
RUS_Karelia_HG:I0211 is half of KAR001 judging by the .bed file, so I think that KAR001 should suffice for the dataset. KAR001 is the only Lyalovo/Volosovo sample so there has been 6K years of drift from Veretye.
@ CrM
''Kubano-Tersk late is a pretty interesting sample''
It is indeed. The North Caucasian group ? Seems to be a post-Catacomb tradition, with catacomb burials, but also cists
''It is probably going to be similar to the Novotitarovskaya culture.''
I think so. As I suggested a thread or so back, these are essentially one population derived from Z2103 Yamnaya (granted with modest cultural & demographic North Caucasian admixture )
@Rob
Where do you think L621 in the Balkans came from?
When I look at this, and if the aDNA record for L621 in the Balkans is really this sparse, I doubt it is Balkan Neolithic in origin.
https://drive.google.com/file/d/1A2ZKJn_YAaWt5jh8ccmRtKKEuskL9nA3/view
@Arza
Can you process the usual 1240K SNPs for likely Proto-Uralic kra001 with your setup, like the last batch? Also these Greek samples...
Cycladic_EBA:Kou01
Cycladic_EBA:Kou03
Helladic_MBA:Log02
Helladic_MBA:Log04
Helladic_EBA:Mik15
@Davidski,
Is it possible to upload the Wartberg samples to G25?
Maybe one day.
So you're saying it is not going to happen. Is this because they are shotgun DNA sequences?
@Davidski
Could you add this sample too?
1419 I0247 I0247 SVP56 bone (long bone) 2015 MathiesonNature2015 Anthony, David Direct: 95.4%; IntCal20, OxCal v4.4.2 Bronk Ramsey (2020); r:5; Atmospheric data from Reimer et al (2020) 2229 54 385-197 calBCE (2220В±30 BP, Beta-392493) Russia_IA_Scythian_questionable Samara Oblast, Volga River Valley, Volga Steppes, Nadezhdinka Russia 52.43 51.16 1240K 2 2.812 926268 .. M n/a (no relatives detected) R1a1a1b2a2a1d~ .. G2a4
@Norfern
Last try. Now let's see what Arza can come up with.
kra001_CT_scaled,-0.014797,-0.478314,0.145946,0.008398,-0.160338,-0.094265,0.022561,0.019615,0.039269,-0.007107,0.090938,-0.001349,0.020961,-0.050645,-0.042752,-0.031424,-0.004042,0.004814,0.004148,-0.003627,0.027951,0.003957,0.000863,0.009881,0.013771
kra001_CT,-0.0013,-0.0471,0.0387,0.0026,-0.0521,-0.0338,0.0096,0.0085,0.0192,-0.0039,0.056,-0.0009,0.0141,-0.0368,-0.0315,-0.0237,-0.0031,0.0038,0.0033,-0.0029,0.0224,0.0032,0.0007,0.0082,0.0115
@ Romulus
Unlike L161 which appears to have expanded widely with the Neolithic, L621 is rare. I presume it remained low freq. in Stone & Metal Ages, only to expand in Migration Age
There might be the isolated case of M423 in Balkans, but my hunch is an south/east Carpathian origin (Wallachia, Moldova). If so, it might be associated with the Carpathian signal in proto-Slavic.
CrM said...
"If Steppe ancestry (Steppe_EBA) was the vector for light hair, eyes etc then Dagestanians would have been lighter than Ossetians, Chechens, Ingush, Karachai-Balkar, Abkhaz, Abazins, Adyghe and West Georgians, but they're not."
Why are you fixated on the Dagestan folks? The fact remains, that populations that have the highest steppe ancestry, also display the highest rate of blond hair, pale skin and blue eyes. Anyway, show me one population that is EEF- rich or of largely EEF ancestry that has high frequency of blondism, very pale skin and blue eyes. Then I'll rest my case.
@Wise Dragon
I'm "fixated" because there's so much evidence that Steppe_EBA is NOT the source of light traits. It is Steppe_MBA or anything that is genetically similar, which is Steppe_EBA + GAC/TRB/related farmers, with those farmers having a MUCH higher prevalence of light hair and eyes than Steppe_EBA. HG populations like SHG, BHG were important too it seems. Later on, selection would make light traits even more common. https://i.imgur.com/krMWKNO.png
"The fact remains, that populations that have the highest steppe ancestry, also display the highest rate of blond hair, pale skin and blue eyes."
Said populations also have a high GAC/TRB or similar ancestry in addition to their Steppe, much like how Sintashta did. Dagestanians are the exception to this rule, far as I know they're the only very high Steppe population that lack EEF.
"Anyway, show me one population that is EEF- rich or of largely EEF ancestry that has high frequency of blondism, very pale skin and blue eyes. Then I'll rest my case."
Among ancients it's GAC and TRB. Modern EEF-rich populations derive a bulk of their Anatolian ancestry from Farmers that did not undergo a selection for light traits.
@SteppeMan
This sample used to be in the G25, but it's no longer there because it's marked "questionable".
RUS_Scythian_IA_questionable_scaled:I0247,0.10927,0.041637,0.036204,0.062016,-0.018465,0.026216,0.001645,0.001385,-0.023111,-0.041732,0.003248,0.000749,0.003122,-0.029314,0.035287,0.015115,-0.005085,0.005194,0.000503,0.004752,-0.002121,0.006801,-0.002711,-0.004458,0.006945
RUS_Scythian_IA_questionable:I0247,0.0096,0.0041,0.0096,0.0192,-0.006,0.0094,0.0007,0.0006,-0.0113,-0.0229,0.002,0.0005,0.0021,-0.0213,0.026,0.0114,-0.0039,0.0041,0.0004,0.0038,-0.0017,0.0055,-0.0022,-0.0037,0.0058
Correction* BER001 is actually the Volosovo sample, KAR001 is another Veretye but younger. BER001 should be around the same quality as I0211.
https://anthrogenica.com/showthread.php?22830-5000-years-old-R1b-remain-in-the-arabian-peninsula
Davidski said...
@Michalis
I was able to run these, but I don't know what most of then are.
https://drive.google.com/file/d/1KdQMZbSg46aXDiSmKmwYlD61RtS136UM/view?usp=sharing
----
Very interesting samples.
Mostly Southeastern Asian and Oceanian. Where did they come from?
“Integrating Linguistics, Social Structure, and Geography to Model Genetic Diversity within India”
https://academic.oup.com/mbe/advance-article/doi/10.1093/molbev/msaa321/6108106
https://phys.org/news/2021-01-ties-india-genetic-diversity-language.html
https://i.postimg.cc/gkGLXH33/screenshot-129.png
India is a very complex place and for sure it wasn’t the PIE homeland nor Indo-Slavic homeland.
@Mike and David, "Ramber2020" looks quite useful; most of the samples from that file with a population label seem to be good for fleshing out the mainland South East Asian picture.
Plotting the ones with a population label on a PCA of East and South Asian population averages: https://imgur.com/a/v6ubqhd
Most labels are as expected: Buma and Burm seem to be Burmese samples (and like other Burmese they fill out a cline between a point similar to North/Central Han and an ASI rich point on the S Asian cline, excepting one sample who seems recently admixed with North Indian BumaBR91), ORI are Austroasiatic speakers from Orissa, Viet are Vietnamese, Luz = Philippines Luzon, etc. and mostly plot with prior samples.
Really pleased to see the Naga and Nyshi samples though, as I've felt they were a "gap" in G25. Most of the samples labelled Naga and Nyshi look like almost carbon copies of Tibetans, and the samples labelled "EastIndia" or "EastIndian" look like they basically people from NE India who are Tibetan like with a little S Asian admix.
There is an odd exception though, where two of the samples labelled Nyshi are basically just S Asian (EastIndiaNyshiD148, EastIndiaNyshiD401).
Samples labelled GRC look interesting, and basically like some big cline of Oceanian admix samples? Probably Polynesians and Austronesian speakers?
The population labels may possibly correspond to this file page 72: http://repositorium.sdum.uminho.pt/bitstream/1822/65091/1/Dissertacao%2B31346.pdf
These are stated there to be mostly/all from Hudjashov et al 2017 (https://academic.oup.com/mbe/article/34/10/2439/3952785?login=true) and Morseburg et al 2016 (https://www.nature.com/articles/ejhg201660).
@Rob
That makes sense. There was a group of FBC that followed GAC southeast, maybe from there?
@ Davidski
Unfortunately I can't. Files are too big. 4-8 GB is already out of reach for my PC, and kra001 has 24 GB. Eventually I would be able to run only 2-3 Greek samples that have bams created also from capture data (400-700 MB).
But I'll try different approach - run mpileup and filtering on Galaxy and then hope that I'll be able to run pileupCaller locally.
old europe said...
"https://anthrogenica.com/showthread.php?22830-5000-years-old-R1b-remain-in-the-arabian-peninsula"
This is all due to the fact that the dating there is completely wrong. The fact is that this burial is located on the seashore, these people ate entirely sea fish. So they have a High Marine Reservoir effect of 2,000 years, which is the norm for the coast of the seas. This means that the dating of this burial is not 5650-5150 ybp, but 3650-3150 ybp.
Many times I have already come across the fact that there in Arab countries they always shout about insanely ancient dating, and then shut up after thorough research has been carried out and the dating they turn out to be 3-4 thousand years younger.
@my previous comment and @ph2ter, yes, SE Asian samples are from those two papers, however also from at least one more for the Laotian and NE Indian and some other samples: https://www.nature.com/articles/s41598-019-40399-8 - "The genetic legacy of continental scale admixture in Indian Austroasiatic speakers" - Tatte 2019.
With that and the other two samples, I could match most of the samples (682/690).
Pastebin: https://pastebin.com/NVmDkXZj (normal sampleID and popID, also country and publication for reference)
PCA: https://imgur.com/a/8MYpy1B
There are about 8 I couldn't match though. They have GRC references but aren't listed in Hudjashov 2016's supplement where all the others with similar refs are from. (Refs: GRC11053495, GRC11053496, GRC11053500, GRC11053501, GRC11053502, GRC11053503, GRC11053504, GRC11053505). They basically seem like East Asians when I plot these in PCA. Hopefully someone else can work out where they're from.
Apparently the Northeast Siberian paper used samtools mpileup... I have taken a look at the WGSextract script and it apparently also uses it instead of bcftools.
Quick introduction of the samples from David's Ramber2020 file upthread who fit the East Asia->South Asia clines onto my most current PCA for that: https://imgur.com/a/2umMtfs
I've highlighted some samples of interest. The Nyshi and Naga are very Northern Han / Tibetan like, while some of the NE Indian Tibeto-Burman samples (Hmar, Mizo, Kuki, Kom) are similar, but with some admix. They also seem to overlap the MMR_Oakaie ancient sample.
Picking a random example, Euclidean distance of Han_Shandong:Naga is 0.0636 or Han_Shandong:Nyshi, which compares to Han_Shandong:Han_Guangdong of 0.0787 and Han_Shandong:Japanese 0.056! Nyshi:Tibetan 0.039. Pretty close (although this may not be capturing any drift specific to Naga that is not in the PCA, so probably underestimates genetic differentiation particular to them). (Comparably English:Czech about 0.044, Ukrainian:Scottish 0.070, Scottish:Spanish_Catalan 0.072).
Two Nyshi samples who are not typical on this PCA for what is you would expect for Nyshi by overlapping the S Asian cline( I mean, the people look like this - https://en.wikipedia.org/wiki/Nyishi_people), I have labelled as Nyshi_o and suspect they're mislabelled.
The populations from mainland and insular SEA with recent contacts with India (Burmese, Thai, Malay) are still very diverse in ancestry, and have not reached any sort of panmixia (so this means the admixture is almost certainly involving a major recent element, the only exception being if its very structured, but SE Asia has no caste or anything like this, though it does have ethnic diversity...).
Thanks, I thought one of the natufian samples behaved oddly, after removing it my results make a lot more sense now:
Distance: 3.5693% / 0.03569309
33.2 Early_European_Farmer
24.8 Iberomaurusian
17.6 Early_Levantine_Farmer
11.0 Africa_Mesolithic
6.8 Iran_Neolithic
6.6 Steppe_Pastoralist
Post a Comment